Description :
From Genome Similarity Track
Location :
Scaffold_496:17841- 21265
Transcript NameFunction/comments
Phyag_g6174hypothetical protein PHYSODRAFT_496419
Phyag_g6175hypothetical protein PHYSODRAFT_342396

Sequence
3424 bases(100 bases per row)
ACATTAAACTCACCGTGCACCAGATACCCCGCGCGAAAAGAGCATAGCGCCAAGTAACGTAAGCTGCCGCGCCTTCTCTCGCATATCCGTAACCTCCGAG
GAAAATGTCTGTAGTGTCAGCGCGAAGGAGATCTAGGGATGCATATCAAGTACAGGCATGATAAGCACAACTCAGAGATGAATTCCTTTTCCTGCTTACC
TCGTTACTAGAGACGTGTATCACGCGTTCACCCTCTTGAGTTGCTAATGCTTCCAGTTTCTCACGCATGTAGGCAGTGAGTTCCTTGCGGCCTTCGAGTA
GTCGGCGATATCCCTTTTTTCCCTGGTAATATTCGAGTCAAGCACAGTTAGATGTTGCAACTGCGTTGCGGAGAAGCATAAAGTAGCTGATTTGTCAATA
AACCATTTGGAGCATGGTGATGAAAAAGTCGATCGTGGGGGTGGCGCTGGCACGCCCAGGGTAGAATTTTGCGACGCGGTCGATGACTTCACGGGTTGCT
GAGCAAACAATTGCTCCTCCTACGGGCACCATGAAATTTTTGTCGAGACTTTGCACCACGGCATCCACGCGTCCAGTGCGCATAGCCAATTCTACTTGAT
GAACACATTTGGATGCCTGGACACCGTAAGCGTTGTTAATTACATGGGCTTCAGCACCGCCCACACATGGCACCAGAGTATCATCAGTAACCATCCAGAA
ATGCAACAAATGCAATGCATCCAACTTACCAATACTCCGCTCCTGGCAAAGTTTGGCGATTTCCTCCACGTTATCATACGCTCGCGGCGCGAAACAGCTT
GTGGTGCTCATTACTGCCAGTATAGTATCACTTCCGTacttctccatcaacgcTGCCATCCCCGCCAAGTCTGTCCTCAAGTACCCACCAGGGTttccat
cctcctcctctacCAGAATattggccagcaccaatgGCGTCAGTCCAGCCGCCAAGATGGACTTGAAGCACGACTTTTGGTCGATCCGAGGCCAAATGAC
GTAGCGCGCATTGGGTTTGGactccttcagctgcagcaacaccagcattAGAGACATGCCAGTGGCCACAGGAAGCACCAGCGCTGCCTGCACCGCTCGC
ATCCCAgcgagacgcagcacgtCCTTGGCCAGAGCGTTGGCGATCTGcaccatgagcgacgacCCGGCAGCTTTTGGCTGTACCGCCGCCACGTCTCCTG
ATCTTCCTACGCCATGCGCCAAGTAGAAATGGCGACGCGCCACCAGCGAAGAGAAAACGCGCGCCTCGCGTTCGCCTGCCCCCGAGCTGCCCCGGAAATT
GTTGCTGTCCATGGCCGAAAgcgtttgcagcagcagctccacactGGCGTCGTCCCAACCTTCGTCCGGGAGGCGGCGCTGAGCCAGAAGCGTTGTCACC
AGCTTCTCTCGCGAACGAACAGCATCCAGGCCCTGCTGCACGTACGAGGACGGCACCAACTCTTGCGCCAAAGCCGCACTCCTCGAATTCATTTGAGTTT
AGACAAAAAAAATTGGGAAAGGATCCATTTTGGGAAAACGGACCCAATTTTGGACCATAAGGTTCCGGAGGTTCGGAGTTGGAGATCAGACGGAGAGGAT
GAACATTTTTCCGGTTGGTGGGAAGTGCCGGCCTCTATTACTGGCTGCCATGGGCAGGATAGTGTTTCTAGCGCTTGGTAGAGCTCACTTTAGCTTTTGC
ATCGCGGCGCAACAGTGCCCCTTCGCATCCGTTCAAGCGACGCTCCAAGCGTCGCTCCAACTACCTCCTCGCTCCGTCCGGTCCCTTCGCCAGCATGCCT
CAGgaccttcttgccgccaaCGCACTCGCCTTCGTGGGCCCTGCACATGTGCCCACCTTATCCGGCTTTTGCTACGTCTGTGTGCGTCGCGTGGAAGGAG
ACACGGCGATTGTCGGTGTAGTTGGTCCCGACTctgacgatgatgaccaaGAAATTGCTGTGCCTGTATCTATGCTGGAGCTTTGTGCGGTTGACGTTTT
CGAAGCCGAGCTCTGGCCGGGCGACAACGTCGGCCACCCTGTTGCCTTTATTCAACCCGTTGGACCATGCACGGGTCAGTGGACGTACGGCGTAGTCACC
CGTTACGAGATCTCCAACGGGGTTCCCTCTCTAAGTGTTATGGTTGACTCTGACGTGCTTCCGGTGAAGCTTCAAGAAACGCTGCGAATTATTAAGGCGG
GCCCAATTACGTACACTCTCCAAGTTGGCGCGACTGTAACGGACATGATCCTGAACCCGAAGGAGCTTTTATAACAACAAAATGCGGTTATTGGTGCCTG
CCGCAAGCGCCGCGGTTATATTCCTGCATCGGTGCGCTCGCTCCTCACTATTCCGTTTGTACctgacgacgtggtggccctCGTGCGTCCGCACGACCTT
TGCGTAGTCACGGTATGCCGACAGCACATTCTCGATTGTTTGATGGGCTCTCGAAAGCAGAACAGCCTCAACCTCTACAAAGACCCTCAAGGACCGACTG
AGGCCGACGCGACCCTACTAAGTATCTCCAAACCACCGCCCATCCGTCCAGCCGACGAGGACCTCCTTAGTATCTCCAGCGGACCCGATGCTGATGATGT
CGGCGACGTTCAACTGCAGAACCGAACGCTTGGGAAGCGGCCACGTACGTCCGACACAACTCGCCAGACTCAACGCACTCAACTTCGTGTGGATCCCTTA
AACAGCGACGCAGTTTCTAGTGATGATGATCAAGAGCCTACCCGAGCTGCATTTCGACCGTCGGCCACCCAGCTGCGGGTTAGCCGAACCATTCTCCACC
AAAGATTCCAAGGTAAGTCTTGCCCATATATATTCAAGCGCATACAACAGCGGTCCAACACGCCATTTCACGCTACGCCTCCTGTCTACCGGGGACTTTT
CGACTTTGGATTTGGCATTCACGGCTTAACGTTGATGCACTGCCTGCCTGTCGATTTGTGGGATCGTGTACACGGCAAagacgccaacaccagcttTACC
GACTTTTTTGAGCGGAATACCCTCCGCCCAGTAGCTCCCGCGGATTCCCGAAGCGACGATATCGGTGCACTCAGGGCATTACGTGTATTTGGTCGGCACT
TCTACAACCAAGCCGTGCTAGATTTGATTGACACGGCCAGCGCCTTTATCGACAGCTACAAAGGTGCGTCCGACACAGACGCTCTCTGCTGGAAGTTATT
GGCCTACTGGGTGACAAATAAATGCAGCAAGTTCCGCGGTTTTATCGTTTCTCGCGTTTTCGATGCTGCACAGGAAGTTCGTCTCGAATTTTCTCGCACG
GATGAAGagctactggagctgctcgacctTTGTCGGCCACATTACAGTGGAGACCGTGCGAACCAACGCAACCGACATGGCCAAGACGACTCACGCCGTT
CTAACCGACAGCCTTGACAGTCTT