Description :
From Genome Similarity Track
Location :
Scaffold_96:178383- 183907
Transcript NameFunction/comments
Physo_141281reverse transcriptase

Sequence
5524 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAATGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTAA
ACTAAGCTACGCTTCCTCACATACCCGCGCACACGTGTAAGCTAACGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAA
CGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAA
CTCACGTTGCACGCGCTGACTGCCCCCACCTGTCGGATCCAGAGTGGAAGGCCCTCCAACGACTGCCAACAGTCATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGAGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGTCGTCCGGG
ACGACACCACGCGCGCAATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCA
TTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTC
GGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTTTCGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGTGACCAAGG
TCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATACA
GGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCAAATGTGCCGAGGCCACAGCCACGACCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTC
TCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCC
CCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAAT
GCAGTTCCGCGTGCCGACCTTGGACACGCGAAACTGAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTG
TCATCCTGAATGTGAACTCGATGAGAACAAGCGGCTCTCGCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACATTGTTCGACTGCGAATTCTATCAAG
ACTGGACTTCGAGGATTTAAAGATACCTCGAAGCATGTTGGAAGTACGACTGGCAACGAGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGC
TTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATG
ATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACACTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGG
TGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCGTCG
CCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCAGAGATCGACACCCGCTTTTCAGCAAATCAGGAAGAGTCTCTGACCTCAAGGGGCACGGATGACG
CAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGATGAAACGCCGTCGACTCC
GGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGAT
GGCGTGTTGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACG
ACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGCAGAACACCCGTCCACGGCTGGGCCTGG
ACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAA
GGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATAACTC
TCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATTGACCAATA
TGCGTTCTCTCGGACGCCGAGAGAACGAAGAGCGAGTATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGA
AGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGA
GATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCTGGGACGAAGTACCGTGTCACGCGGCAGTGGCCACTGCCGCGA
GAGCAGGTCAAGGCGACCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCA
AGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCAT
CGATTCGATGGCCAGGAACACTATCTACAGTGCTCTTGATCTGTACGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCCGTG
AGCACGCCGAGCCGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCG
GTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGCCCACAGCCGGGCTACGGACGGGGTGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGA
AGCTGCTTGCGCTCATGCGCAAGCACAAGATCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAA
GAACGGTGTCCGCCCTGACCCTGGGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACG
TACTTGTGCAAGTACGTGAACAACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGGCTGCTGAGTGTCAGC
AGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGTGACGCTTCCGAC
TTCGCAATCGGATGTGCGTTGATGCAGCACGACCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACC
CGGTACATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCAACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGC
GTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCC
GGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCGGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCC
TAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTTCGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCG
TCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCATGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTT
GTCGTGCCCAATGATCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCTGTGAGAAGACATACCTTCTTC
TCACGCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGTGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCA
GGCTCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGATCGGTCTTCCCCCGGACAGCCAGAGGAACACGGAC
GTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCTGTACCCGCTGAAGTGACTGCGAAGCAGACAGCGCGTCTGTTCGTTGACATGG
TGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCA
ACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGGGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTC
CAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCTGGC
ACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTG
TACAGTGTCAGCCGCAACGACACG