Description :
From Genome Similarity Track
Location :
Scaffold_25:178336- 179629
Transcript NameFunction/comments
Phyra_77533eukaryotic translation initiation factor 4E-like 1

Sequence
1293 bases(100 bases per row)
TGTTGATTTTGACGAACCATAAGGCAGAATTTCGCGGTACTTTTGGCAAATCAGGATCGGCACTAACCGACCCCCTCCTCGATATAAACACAGCACGACC
ACGAGCGCAGCAGGATACGGCACACGATGGCGTCCGGAGACAGCGAGAAGCACGAGCTCAACGAGCCTTGGGCCATCTGGGAGCAGCGCGAACAGGGGAA
GAACATGTCGTACGGCGACAAGCTCTTCAAGCTCTGCAGCTTCAGCACCGTGGAGGAGTTTTGGGGCTACTGGAACAATATCCCGTCGCCCAGGTGCGCC
ATTCCGCCATCTACAGCTGCCACTCGGAGCCGTTACAATGTCTTAACATGCATTGGATGACGTGTTTTGTTATATTGTATCTGGGGATCGCAGCCAGGTG
CTGTTTGACGGCTTCACGCGCAAAAAATTCGCGGACCGAACGGTGGAGGGCTTCGCTGTGTTCAAGGAGGGCATTGTGCCCGAGTGGGAGGACCCCGAGA
ATAAGAACGGTGGCGAGTGGTCCATCCGGAAAGGTGCGCTCGTCTTGTTCACGTGTGGAGAAGCTGTGGACTCATTCGTTTCGTTGCAATTGCCAGAGGT
TGGAGCTCAGGAGCTGGACGCGTTCTGGGAGAAGCTAGTGCTAGGTGCCATTGGAGAGCTCATCGACTCAGGCAACGAAGTCACGGGCGTGCGAGTCATC
CACAAGGTACGCGCTGGAGTTTGGTCTGCAGCGTTTGAAACAATGCTGCTACTTTGAAAGAATACGATTGCTATGTGCAGAGGTCTGACATAGTATTTCT
TGACTATTGCCGCGTGCCCACAGAACAACAAGAAGGACAAGAAGGACTCGGGCAACAACTACCGCTATGAGATCTGGCTGCGAGGCGTGAGTCGCGCCAA
GGCGGACGAGATCCGTAACAAGACGCTCGACGTGGTCAACTCGGGCAGCTCTGGCGCGCCTTGGGTGTCCAATGAGTTTTTGTACAAGAAACACTAAGTG
TAACCAGTCACAATATGATCGTCGGCGCTGCTTCACGGGTCAGACAGATGATTCTGCGGTGCAACAGAAACAAAGACGCACAAGGATGTGCATCAAGCAG
GAAGCGTCTGGCGATTCAACCAAGAATGCAGCAGGCGATTGAGACAGAGCAGATACGAGGGAGGTAGAGGTTGGCGGTCAACGCTACGCATCGCAACCCC
ACGTTGGTAGCATGCTGCTGCCACAATGTGAGGATAACAAGAAAAAACAAAAAAATAGACTTTTCCTAAGTGGCAATAATACAAGTGCCTGGT