Description :
From Genome Similarity Track
Location :
contig_78:17832- 19666
Transcript NameFunction/comments
g12530.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae

Sequence
1834 bases(100 bases per row)
TTTCAAGGCGATGGAGTACCCCCTGTATTCACACTTAGCCCCGGATCAACGGTTTGGAGATAACTTGCCCAAGCATGTGCTATTAGCCCAGATACATATA
GGAGCGGAGGCTACAGCCTCCCAAAACCAGGAAATCAAAGATCTAAAGACGGACCTGTCTAGGATTTCGCTCGATATAGATATACCAGTGCTAACAGTGC
TCTTCAAAGGAAAGAGAACAGCAATGGTTGGTAATTGTCACTTGCGATGAAGATGCTGCCGCTTATTGATGTAACGGGGTTATATGAAGAGTACCCGTCA
CTCTTCCGAGTTGGGTACATGGTGTATCCAACACCACTAACGCGTGGATGGTGACACGGTTTTTAGGTAACTATAACTATATCACTATAATATCTACGTT
CTTCAAGTCAACCGTTCCCTTAGACCGGGAACCAGCGGACTGCCGTTCACTTGCAGTTTGTATACTCCTAGCACTTCCTCAAGCGCAAGGTGCTGTGTGA
TCCCGTCACAATGTAAGCCATGTGAAGTACCCTGACGAAGCAAATGTAGCGCAACAAAATGCAGCGAAGAGAAGCGAAGTTAAAGGGATACTCCGGTTTC
CTGGAAGGCAGAGTACAGCCAAGTTCAGCTGGCTACATGTAACGATACTGCAAGCCAGACCAGACAAGAATAACTGGACGTAGTTAGCATCTGCAAAGCC
GATGACTCATCAAAGAAACCTAGTTAGCGAGAATTCATTTAGGAAGTGCAGCTACAGCAAACAGAACAAGTCAAGCAGCGTCGAGGGTTCAGCGACCAGT
TCGTAGCTCGTAACTATCCCGCAAAGACGACAGCCCACATCCTTCCTTTCCGCTATCATGTGGTAGTTTGTCACTTTTCTAAACTCATACAAAGTGATAA
TTCCGCTGTTGGTGGCTTCCCTTAAATATTAATAATAATGTTGCGGTGTATTGTGTCACTTACTCCTTCGAATTGGACTGTAATAACCATCCTCAACAGG
TGCTTGCTTACTGTCGAGTTGTGCAGCCTCTCCTGCTGCATGTTTCGTTCTCATCCTTTGTTGTGCACTTATAGTGCCCCTTCCTCCTCGATCCATCGTA
CACAGTTTCCTCTGATACGAGCTTCGACTCCTTTGCGTACAGGATGCTCATCATCTACATCTTCCATCGTTATCATACAGCTGGCCTTGGAATCATTCGC
CAAGTTTCCTAGCCAATCTGCTGTTGTGTTGTGCTCTCTGTACTGATGTGTCCAGCTCGCTACTTGGCAATCATATGCCAGGCTTCTGGATATCCTGTAC
CAGTCCTGTATCTTCTTGCTTTTAGGTAGCTTTCGCTCCTTCAGCATCCTGATATTCATTGCGCTATCGCCCACCCTATGCAATCCGTACCACCGACATT
CCGTTGTCCATTGCAGCAGTCTGTGTAACCCCTCGAATTCTGCGACGTTGTTAGTTACCGTGTTGATGCTAAGAGCCGTGGGAGCTGCCCGCAGTGACCG
CACTTCTTTGGCCCTCTCATTGCCATTATAACACCGCCACTTCCTCCAGAGCCCGTGTTTCCTCTTGATCAGCCGTCGAAGAGCCCCAATCGTTCACAAA
TTGCCATCCCTTTTGTTTCGTCAGTCCGCGCCGTAGCCACTCTTTTTCTGCTAGCTATGAAGGCCACCGTGTAGCGGGGCTACACATTCGGTTCACCTCC
TACCTTAGTGCAACATGCACTAAAGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAAGCATATGACTGGTAGAAAGTAACACCT
TTCTACCAATGAGAGTCATTCAATAGATAGGGGT