Description :
From Genome Similarity Track
Location :
Scaffold_686:17827- 19326
Transcript NameFunction/comments
Phypl_g10317hypothetical protein

Sequence
1499 bases(100 bases per row)
CTACACCATTTCCCGGTCAAGTTGCCAAGTTTTTCAAGCAAGATGCAAAGTGCATAATTCGGGAATAGCCACGTTTTTAGCACTGTACACAAACATACAC
TTTCACGTTTTGCAAAACTGCCCTTTTCTCTTTTCAAGCAAGTTACAATGCAGACTCAGGCGCCTAGCTCCATGTtctcctctctctctgctgcGAAGCA
GTGGCGAAGGCAGTGCCGCTCGTAGCACCACACAAGGCGCTGGGTGATCATCACTGACTTGCTGGTGTCAAAAGCCTCGCGTAGAATGGCCATGCGTTGA
GCTGTGAATGTGTCGTATTCACCTCGAACCATCATTTCGTTCTTGCGCTCCGCAACGAAGCGCTTCATGCGCGCCTTCAACGAGTTCCAACAGCCCTCGA
TGGGATTAAGCATCGGACTGTATGGACCCAggcgcagcaccaccagcttgttGAGGTTCATGATGCCATCTTGGAGAAGTATCTGCCGGGCTAGATCCTC
GACCTGGCTGTGGGCGGGCGCGTTATCTGTGACGACTACGATCTTCTTGCtagcctcgagctccagatACTCGTCCGTGCGAAGCGCGGCCATGAACAGA
TCCGCTAAAAAGCAGGCGTTCACTTCCTTCTTGACGGAGCCCTCGCGTGTCTTCATCAATATCACCCCAGACCCGGACGACCCTCCGCCTTGAATATGAA
GGTTCTTGCCTTGCGAAGGCGGTAAATGGACGACAGCACGCTCACCAATGCGTGACCAGCCTTCGGTTCGCGGCAGATACAGATTAAAGTTAGTTTCATC
CTGAAATACAATCATGTTACCTTTCTTGATGTGCTTgtccagcgagtcgacgaagtccttgcgcttggccttATTCGCGGACGTGTTCATCGTAGCCTTC
TCGACACGCAGTCGCTTTGTAGAGTAAAGCATTTCTTGTAGAGAGCGATGGACTGGTGTGAGGCTCACAGAGACCCCCAAATCAGACTGCAGGCGATggc
tgagctgctcgagtgtcTGCCTGCAGTCTTCGTCAATATACTCCTCTATTTTGCACATGACATCTACCGTCATCTTGACGTTAGCGGCCCTCAAGCCGTC
ATGCTTCTTCGGCTCTTGATCCGCCGCTAggacagcacgtcgagcCGTGAAGTAGTTCACGTAGTTGCTCTTCGCTACCTCCTTCTAGTCGCGGCCTTCT
TAAAAAGCTCAAACAACCCGAGCTTTAGCCTGTGCTCGCTCGTACGCCTTTGCAATCTTCTCGGGGTGCGGTGGAGATGGCATCTTTGGGAATGAAATGA
AAACAGGACAGCTTCTGGTGGAAGCGTTTTGGCGCGCAGTCTCGCGCCAAAACGAGTGGTTTGCAGCTTGAATGTAAAGATTTCGGAGGGAATATGCAAA
TCGTGAAAATGCACCTTTTATTCTTTTTTTCGGGCCTCCGGATTTTGTTATTTTGCATCTTGATTGACAAACTTGGCAACTTGACCGGGAAATGGTGTA