Description :
From Genome Similarity Track
Location :
Scaffold_152:17824- 19747
Transcript NameFunction/comments
Phyag_g2791hypothetical protein

Sequence
1923 bases(100 bases per row)
TGATCGCTGTGAACCCTTTTAAAGAGATCTCGGGGCTCTACGACCTCAATAAGTTCCACGAGGAGATGCCCAATTGGACGGCACTACCACCTCACGTGTT
TTCCATTGCAGAAGGAGCTTATCGATCGCTACGACgagagaacaagaagaaccagacGATTCTCGTGAGTGGAGAGAGTGGAGCTGGAAAAACGGAGACG
ACCAAGTTTATTATGAATTATTTAGCCGCCGAGAGCAGTCGGGAGACGACACCCCCTGCAAGCAGCAATAAGCGGAAACGAGCTATCAGCGGCAGTGAAT
TGATGAGTGCCAACCCGATTTTGGAGTGCTTTGGAAATGCCAGAACACTGCGCAATGATAATAGCAGTCGATTCGGCAAGTTTGTGCGCATGTTCTTCGA
GGGACATGAACTGGATAagtcgttggcgatggtggGCACGTCCGTGGAGACATACTTGTTGGAAAAGGTGCGTGTGGTGCACCAGAACGACGGAGAACGG
AATTTCCACGTGTTCTATGAACTATTAGCTGGAGCTGATGATATTATGAAGAAGGAACTGCAGCTGGAAGGTCTGACAGCGCACGAGTTCCAGTACATTA
ATGGCGGACAGTGTTTCCAGAGAAATGATGGAGTGCGTGACGACAAACAGTTTCAATTGGTGCTGCACTCGATGGAAGTTTTGGGTTTTACAGATGTGGA
GCAAGGAGCGATCTGGAAAATTTTAAGTGCGCTGTTGCACCTAGGAAATGTGCTGTTTGTTGCTTCGAGCGAGGATGAGGGCGAGGGAGATAACGGAACG
GCATCAGCTCCATGTCGTCTCGCATCtgcgtcgccgtcttcgctTACGGTGCAGGAGCATCTTGATATCGTGTCAAAACTTTTTGCGGTCGATCAGGAGG
AACTGCTGTCAGCGCTGACTACGCGAAAAATCAGTGTTGGTGGCGAAACCTTTCATGCAAATTTGAGTTTAGCACAGTGTGGAGATGCTCGAGATGCCAT
GGCTCGCTCGTTATACGCATTTTTGTTCCAGTTCCTGGTTTCTAAAGTGAATTCAGCCTCGccacagcttcagctgcccGCGCATTCTGCACATAAAGCA
ACAAATAAGGATGCAGCGGCGGAAGTACCGTGCATTGCTGTCTTGGATATCTTCGGTTTTGAAGAGTTCGAGGTGAATCAGTTTGAGCAGTTCTGCATCA
ATTACGCGAACGAAAAGCTGCAGTACCAGTTTATCCAGGACATTCTTTTGACGGAACAGCAAGCGCATATCGAAGAGGGGATTAAGTGGAACGCTGTGGA
CTACGAAGACAATTCCCTGTGTCTGGAAATGGTGGAACAGCGCCCCAGTGGTATTTTTTCGCTTCTAGACGAGGAATGCGTTGTCCCGAAGGGAAGTGAC
GCAGGTTTTGCGCGCAAATTATATCAGCGACTGCAAGAGCACAGCAACTTTAGCGCCTCTCGAACTGAGCAAGCCGATTTTACCTTTCAAGTTCATCACT
ACGCAGGCAATGTTCGATATCAAGCAGAAGGTTTCTGCGAGAAGAATAAAGACCAACCCAATGCTGAACTGTTCAGCGTTTTGGGGAAAACAAGTGACGC
TCATTTACATGAGCTGTTCGACTTTTTCAAGGCCAGTGAAGCagcacaacttcaactgggCCAACCTAAGCTGAGGCGGCGTTCTTCAGTACTCAGTTCG
GTGGGCATCGGCTCTCAGTTTAAGCAACAACTAGCGAATTTGCTGGATGTTGTGCAGCAGACCCAAACGCACTACATTCGCTGTATCAAACCCAATGACG
AGAGTGCGAGTGACCATTTTGACATGGCAAAGGTGTCGAGTCAATTGCGCTACGGAGGTGTGCTCAAAGCTGTGGAGATCATGCGTCAGTCGTTCCCCGT
TCGCATGAGCCATGCTGACTTCG