Description :
From Genome Similarity Track
Location :
Scaffold_147:178161- 186192
Sequence
8031 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGAACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCCGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCCCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGAGCCTGATGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTAGGAGCAGGGCCTCATCGCGCATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGTGTCCGAGAAGTAGAGCTCGCGATGAACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGAATCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCA
CCCTTGAAGAGGCGATTCACGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGCTCCTTGTCGGCTCC
CGGCCGAACAAGCCCCAACTGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCATTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCTG
GGAACCAGTAGGGGCGGGGCACCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGG
CGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAACAAGGGCAACGGGACGGTGTCAGTGCG
ACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTCGAT
CTGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCGTGCGC
AGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGG
AGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAAC
TTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAGCAGCGTGTTCAGAGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCTTAACTGAAG
AGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCCTAACTGAAGAGGAAGGCGTGAACACGCTTCCTGTGTG
GGTACAACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACTTCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCA
ACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCG
GTGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGA
ACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGAAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCT
GAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAAGATCCG
GTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGC
CCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGT
GCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCA
ACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAGCAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACT
ACCAAATCCTGATGCGCGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAA
CGCCCCAGCGACGTTCAATCGTCTGGTGACGCAATTGTTCCGCCCTTAGCGTACCTTCGTACAGACGTACTTCGACGGCATATTCGTCCATAGCCGTGCC
GAGGGAGGCAAGACGGCCATGGAGGTGCATCTAAGTCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCG
TTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGAC
GCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGGGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGC
CTCCTTCAGAAGGCGTCGACTGGCGCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCC
GGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGGCACGGCTGGACAGGAACGAGTCATC
TCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTC
ACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGATCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCT
GTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGGGGACGCTCTCTCTCGGCGTCCCGACTATGAGTTGGCC
CACATCACGCGAATGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTAAGGCCGGAA
CGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAACGCTCACGGCTCCACCGATATGAGTTGAAGGGGGGCCTCCTCTATTCTCGGGTGGAGCCCACTGA
TCCTCCACGGGTGATCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTTGCGGAGGCGCATGACGCGGCCTCCAGCGGCCACTTGGGCCGCGAGAAG
ACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCG
CAGGGCACTCTTCGGCTCCACTACAAAGCCTGCTCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTAACTTCATCTTTGGGCTTCCCGCCGACGGACA
CGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTG
TTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAAACGATTGTCTCGGACCGAGACCCGCGGATCGCTGCCGCGTTTTGGAAAACGCTGTTCCCTT
TACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGAGCTCGAGGACACTCTGCGCAGTGT
GTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCAAGGGGTTTACGCCGTTCTAC
TTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCATTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCC
AGGTCTCGGATGTAAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGC
AGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTA
CCTCTAGCCACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCG
ACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGA
CCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGT
ACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGC
AGGCGGCTCCGGACGTGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCA
GGCTCGCGACCCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGTCCCTGGGGCGGCAGCATTACCCGCCCAGTC
CCAAGGCCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGA
GTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCT
CCAGGAGCAACGGTGTCGCGGCAAGCGACTGCTCCTCATGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATT
GACTGCCCGAAGGCTGTCGCAATCTGAAAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACAT
ACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGA
TCACGCTGGTACAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACGCCGTGGGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGT
CCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAAAGGTATCCTTAAACAGGATAGAGACCACCCCGGGTCTCAGGCTTCTTACGACAAGT
CGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGT
TCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAAT
ACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAAACCCTCCTGCTGCTGGTCGAG
GTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAG
GAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGGGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAA
GACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACA
GAGGTCCTGGGACTGTGATCACCCTGACCCCCAGCGCGCGACTGCACGCTACCTACTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCG
CAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTTGGACGGTTGTCTGAAGACGA
GGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACTTGAGGAACCGATCGCCTCTGAGGCCACCTGAGTAGCCTCCTTGAGTGCA
GAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGTAGTGCCACGAGGCATGT
TAACGATCGAAGTGGAGACCCAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGAT
GGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTATACGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTA
GCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAAGTTGTT
CAAAGCCAACCATTGGATAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCGAACTTATCCTACCTATAAATATACTCAGTTTACA
ATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCAGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTC
TTGCGCAAGGTGCTGTGTGACCCCGTCACAT