Description :
From Genome Similarity Track
Location :
contig_78:17815- 19650
Sequence
1835 bases(100 bases per row)
GGCGATGGAGTACCCCCTGTATTCAACTTAGCCCCGGATCAACGGTTTGGAGATAACTTGCCCAAGCATGTGCTATTAGCCCAGATACATATAGGAGCGG
AGGCTACAGCCTCCCAAAACCAGGAAATCAAAGATCTAAAGACGGACCTGTCTAGGATTTCGCTCGATATAGATATACCAGTGCTAACAGTGCTCTTCAA
AGGAAAGAGAACAGCAATGGTTGGTAATTGTCACTTGCGATGAAGATGCTGCCGCTTATTGATGTAACGGGGTTATATGAAGAGTACCCGTCACTCTTCC
GAGTTGGGTACATGGTGTATCCAACACCACTAACGCGTGGATGGTGACACGGTTTTTAGGTAACTATAACTATATCACTATAATATCTACGTTCTTCAAG
TCAACCGTTCCCTTAGACCGGGAACCAGCGGACTGCCGTTCACTTGCAGTTTGTATACTCCTAGCACTTCCTCAAGCGCAAGGTGCTGTGTGATCCCGTC
ACAATGTAAGCCATGTGAAGTACCCTGACGAAGCAAATGTAGCGCAACAAAATGCAGCGAAGAGAAGCGAAGTTAAAGGGATACTCCGGTTTCCTGGAAG
GCAGAGTACAGCCAAGTTCAGCTGGCTACATGTAACGATACTGCAAGCCAGACCAGACAAGAATAACTGGACGTAGTTAGCATCTGCAAAGCCGATGACT
CATCAAAGAAACCTAGTTAGCGAGAATTCATTTAGGAAGTGCAGCTACAGCAAACAGAACAAGTCAAGCAGCGTCGAGGGTTCAGCGACCAGTTCGTAGC
TCGTAACTATCCCGCAAAGACGACAGCCCACATCCTTCCTTTCCGCTATCATGTGGTAGTTTGTCACTTTTCTAAACTCATACAAAGTGATAATTCCGCT
GTTGGTGGCTTCCCTTAAATATTAATAATAATGTTGCGGTGTATTGTGTCACTTACTCCTTCGAATTGGACTGTAATAACCATCCTCAACAGGTGCTTGC
TTACTGTCGAGTTGTGCAGCCTCTCCTGCTGCATGTTTCGTTCTCATCCTTTGTTGTGCACTTATAGTGCCCCTTCCTCCTCGATCCATCGTACACAGTT
TCCTCTGATACGAGCTTCGACTCCTTTGCGTACAGGATGCTCATCATCTACATCTTCCATCGTTATCATACAGCTGGCCTTGGAATCATTCGCCAAGTTT
CCTAGCCAATCTGCTGTTGTGTTGTGCTCTCTGTACTGATGTGTCCAGCTCGCTACTTGGCAATCATATGCCAGGCTTCTGGATATCCTGTACCAGTCCT
GTATCTTCTTGCTTTTAGGTAGCTTTCGCTCCTTCAGCATCCTGATATTCATTGCGCTATCGCCCACCCTATGCAATCCGTACCACCGACATTCCGTTGT
CCATTGCAGCAGTCTGTGTAACCCCTCGAATTCTGCGACGTTGTTAGTTACCGTGTTGATGCTAAGAGCCGTGGGAGCTGCCCGCAGTGACCGCACTTCT
TTGGCCCTCTCATTGCCATTATAACACCGCCACTTCCTCCAGAGCCCGTGTTTCCTCTTGATCAGCCGTCGAAGAGCCCCAATCGTTCACAAATTGCCAT
CCCTTTTGTTTCGTCAGTCCGCGCCGTAGCCACTCTTTTTCTGCTAGCTATGAAGGCCACCGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTA
GTGCAACATGCACTAAAGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAAGCATATGACTGGTAGAAAGTAACACCTTTCTACC
AATGAGAGTCATTCAATAGATAGGGTTCTGCCAGC