Description :
From Genome Similarity Track
Location :
contig_62:178139- 180359
Transcript NameFunction/comments
g10914.t1hypothetical protein

Sequence
2220 bases(100 bases per row)
ACATTTGTTCTCCTGTCGCTGTCGAATGCTATAACACCAAGTTTACGGGAATGTGGGATTCCCCGTAAACTTGTTGTGTGCTCGATGCCGCCCGCCCCCC
CCCCTCAATTCGTAAACCTCTCCCAACCACCTACTTCGAACCAAAGTCCCTTTGTTCAGCAGCTAAGTCTAAACTATGCGCCTGACACATATCGCACTGG
TAGCTGCCGTTGGCCTCCTTACCCAAGTTGACGTTGACTCGGACCCCGCGACGATAAACTCGAAGCCAGCCATCTCTGACTTGCCAAGCATTGATCGTTC
GCCCCTCGCAGCAACAGACGTCCCCAACAACAGGCGTTTAAGAACTGACACAAAGATGGACAATGGCGAAGAGAGAGGAATCAATTTCGACAAAGCCAAG
ACCTGGATCATGCCGAAAGTCTCTAAACAAAAACTCGAACGCTGGCTAACGAAAGAGAAACCTGTCGAAAATGTCTTTACGCGATTGCGACTTCGACAGG
CAGGCGATAAGCTGCTCGGTGACCCCCAGTTTGCAGTTTGGGTGAAATACGTCGACGATTTAAGCAGCAGGAATCCCAAGAAGACAACGCTGACGATCCA
TGTGCTGCTTACACACTACAGCGACGAAGCTCTGGTTAAAATGGTGGCAGATGTGAAGACCATCCCGGAAACCAACACATTTGCAATCAGGTTGCAGAAC
GAGCTAGCCGAGTATTGGTTGACGAAAGGGAAAACACCAGGCGGCATCTTCACTCTGCTACAGCTTGACAAGGCCGGAGATGATATTCTGACAAGTCAAA
CGTTTAGCATCTGGAAAACGTTCTTGAACACGTTCAACAAGGCGAACTCTGGCAAGACGGTGAGTATGTTTGGAACGTTGATGAATCAATACGGCGAAAT
CGGTGTGTCAAGAATAGTGGAAGCATTGAAGGTCAAAAGTTCAAATTACGTCGCCAAAACAGTTCAAGCGAGCAGTTCCAGCGCTGGATAAGACGTGGAG
AGTCTCCGAACGCTGTTTTTGAGCTGTTAAAGCTGGACGAAGCAGGTGACAACCTCCTTGCTAGTCCGTTGTTGGATACATTCACCAAGTACATGAGTAC
TTTCAACATGCAGCATGGGGAGCAGCAAGAGACTTTGATCGCAGTGTTGACCAAATACTACGACGTACCAAGCCTTCTAGCCGCAGCAAAAATAGTTCCG
AGCACATCACGTCTTGCCAATAAGTTAGAAGCACAGCAGTATCTGCACTGGCTGAAGACTGGCTACGACCCCGAAACTGCCTTCATTCTGCTTGGACTTG
GTGATGCAGGAGAGAAACTTCTCACCAAATCAAATTTCGCTACTTGGCTGAAGTACACTGATGCTTTTCACGCTGACAACCCGGACACAACATTGAAAAC
CTTGAGTATATTACATAGTTACGCCAAAGGTGCTGGGGGGTTGCCCCTTTCGGACGCTGCTCTAGCCAGAATGACGGCGATTGCAGAGAAGAATCCGACT
ACGATAAATGTTGCCAAACGAATGAAAGCTGTCCTGTTCCAAGGGTGGATGCGCAAGAGAGGTCACAAGACCACTGACAACGTCTTCACCATGCTAAAAC
TTGATGAAGCCGGAGAAAGACTGTTTCAAAACCCCATGCTTGAACTTTGGATGAAGTACGTGGATGGTTTCAACAAAGCGTTCCCAAAAGAGAGAGAGGG
TATGAAGATTCTGACGACAAGCTACGACGACGCAGTTCTAGTGAAAATGATCGAATTGGCGAAGAAAGATTCGAGTACGAAAGAAGTGGCCACCAAGGTC
CAGAGTGAGATGCTTACTCAGTTCGCGAACGCTCAAAAGAATCCGGCGTATGTTGGCAAGCTGCTAAATATCAAGGACAAGACGGATGCGAACTGGGGTA
TTTGGAAGAAATATCTGCAAGGCTATCAAAATTTACACTCCCCCGCCATGACGTAGGACGCTTGAGCAGCTCACAAACGCGTAGGATGATATACGGACGA
CAAACCTGGTATTAGTTGGAACAAATAGTTTGTTTCCTGGATGACTCGCTGACGGCGTCTATGCACTGCACACAGTTAGGCGGCTCCGCTACGTGTACTT
CTGAGCTGTCTGATATTGAACGCGGGGTCCCTGCCTAGTGCTAGGTTAGCCATATAGAGTAGCCACCTCGCTCATATACCAGCTCATTAACGAGTTGTGA
GAAACTCGTTGATGGTCGAA