Description :
From Genome Similarity Track
Location :
scaffold_205:17811- 19381
Transcript NameFunction/comments
Pl_107734callose synthase, putative

Sequence
1570 bases(100 bases per row)
CCGGTGGCGCAGCATAGTGCAAAGTACACTTCCCAGTAGTTGTTGGCATTTCCACTATCGTCCGCGTTCACCTGAAGCGTCCGACGAATCAACAACGTCT
GTGACATAACGAGACCGAACACAGCTTGGAGCGCGAATACGATAGACAGACGGAACATGAGGTGGTTTTCCCTGGTCTTCTGGGCCAACTCAGCTTGAAT
AAGCACAATCTCGGGGTTCACATTTTGGCGCCGACGCAGGCGGATGAGCACAGCGCGAGCCGGCTCTTCCTGCTTGTGTGCAAGAAGCCACACCGGGCTT
TCAGGCACGAACCACAAGACGCCGAAAAACGCGAGAATCAGCTCCGGTTGCACAAACAAGGGCTGGAAGCGCCACATATTCGTAGGCTTATTATCCCAGT
CTTCTGAGATCGTTGTAGCGTTCGTATTAGCCATCAGCAGCGAGTGTACAAACCAACCGATCATAGAGCCCATCAAGAAAATAGTGATACTCTTTCCTCG
CCACCCCTTCGTGCAGATCTCGTAGCTCCACAACAAATAGTTCATCGCCATCATAGCGGAGCCCATCGCTGCCATTCCACATGAGACGATAATGATCGAC
GTGCTTGGGATGAAGTTGAGTCCAAGCGAAATGAATATCAAACTGCCACCAATAGCCATGTTGATACGTCGCCCTAGGACGCGACCGATCAGTAGCGAGA
GTAGAACAGCAACAATACTCATGGCCGAGCAGGTAATCTTCAGATAGCCGTTCTCCATGTAGCTCAGCATCTCTGATCCATTGTTTGGCAGCTTTGTCGT
CACGAAGTAGTAGAACGATCGGTTCATGAAGTTTTCGTCGGGGTCGTTGATGTATCCGAGCGTGTATAGGAACGACGTCATGAAACCATGGATGAAGCCA
CCCATCAGACCAAGCAGAATGACCAAAGATGCCGCCACTTCCGAGCCAGAGCTCAAGGCACGCGAGAAACCACCGTTGTACATTGCGCGGGTCTGGAGGA
TACGCATGAACGGCAGCAGAGACAGCAGGAACAACGGAATGACCAGGAACAAACCGACGAGCATATCCATGAGGAAACCGAGAGCCATCATGGGGCTCCA
CATCGCCACCTCCATTCCAAAGGCTCCGTTGAACGCCAAAGCATACTGCACGATCGAGTTGAAACCCAAGATCATTGCAATCGAGAATGTAAAGCACTTG
AGCACTGACCAGCCGCCTATGCCTCCAAAAATCAGTGGAATCAACAGGATACCTCCAATAACGCACACCATGTACATGATTCCTTGAATCGTGAGCGAGT
TCAGTTTGCGGTGCTTTGATACACAGTGGTGCACACGGTTTCCGAACCAGAGCAGCACCCATGTAGCACCCATCGCACCAAACAGGAGAGCAAACCACGG
AAGGGTAAATTCCGTCAGAAAGACGTAGTACATCGCCAACGGGTGACGCAGCTCACGAATACAGTATGTGATACGGCCCATTGGGCCTAGAGGTACCATC
AAGTCAACATCGGATTTCCACCAATCGTCCCATCCATCTTTTGGCTGTATTAAAGCAGCACTACTGGCAC