Description :
From Genome Similarity Track
Location :
Scaffold_305:1781- 3134
Transcript NameFunction/comments
Phyta_totarag6897lamin-like protein

Sequence
1353 bases(100 bases per row)
CGCGTCCTTTTTGGCGCTAGCCTtcactcttcttctccgtcgcctCTCTGCGTCCACAATGCCGACGGAACTGTCCCCGATCAAGTCCAAGCGGATGGAG
GAGAAAGCCTCGCTCCAGGTGCGTTCAACACCACCTCTTGTGCTCAAATCCGCTCACTATTGACTAAGACAACAACGGACTAAGACAATGTGTTTTTATT
CTGCTTTTACTCTGTTTTAAATCCTCTATGCAGAAACTAAACTCGCGCCTGGAGATGTATGTGCTGGGCGTGAATGAGCTGGAAGGAGCCAAACATGCAG
CGGAGCGAGAGCTGGAGACCATCAAGCAGCGCATGCAGCAAGATCTGGAGAGTGTGCGCTCCAGACTGACTAAAGAACTGGAGGAAACGCGCAAGTATGG
AGTTTTGTTTTTACAATAGTATATACTGTTTTATGCTTTTACTAACTTGTTTTAACACAGGAAGTTGGACGATGAAATGGACCAGAATGCGcggctgcag
acgctggagcaggaacaatacaaggagctggtgaagctgcgcgcgcaACAGACGGAGCTGGGGGAAGCCaaagtgctggtggagacacTGCGAGTGCAGC
TGGACAGGGAGAAGGCCAATGCCAACTCGGCCAAGGAGACACTGTCGGAGCAGACGACGCAGTTGAATACGGCGCGACGTCGAGTGAAGGTGCTTGAGCG
CGAGATGCGTGGCCATGTTGCGGCGCTGAGTGACGCTActcaggagctggaggagctgagAAAGAAGAGCGCGGACTTTGACTTGACGCGAGATGCGGAG
CTCACGAAACTGCGACGGGAATGGACGGCGAAACATTTGGAGACACAGGCACAGTGGAAGAAAGATGCAGAGGACCGACTGCATacgatggagatggaag
TGCGCAGCCACTTTGATAGTGTCTCGGGAAGTTTGCAGAATCAGTTGGATGATGTGAGAGCAGAGCTGGagagcacgaagaaggagcttGACCGCACGGC
GAATGATTATGAAGAAAGTCTCAAGGCACGTCAGGCCCTTACCGAGAAGGTGGCGCAGTTGGAACGTGACTATCGTGAAGTACGGTCTAAGTCGACGAAG
GATCGAAAAGCTTACGAAGAAACGCTGGAGCGGTTCCGATCGTCCAAGGTCGCTAAAGAGCGCGAGTTTAACGAGCTGATGGACGTCAAGATCGCCTTGG
ATGCCGAAATCATGAAGTACCGCCGCATCTTGGACCGCGAGGAAAGCCGCGTGGCCGTCGCGACGCCCAACACAAAGGGCCGCAAGCGGAAGAGCGAGAA
TACGAACGGTACTTCGTCCAAGCGGGCAAAGCGTGCGGTTCTTGAGACAGAAA