Description :
From Genome Similarity Track
Location :
contig_62:178072- 180292
Transcript NameFunction/comments
g11413.t1hypothetical protein

Sequence
2220 bases(100 bases per row)
CAATGCTTAGGCATACATTGTGCTCCCATCCGAAGTGCAACTACATTTGTTCTCCTGTCGCTGTCGAATGCTATAATACCAAGTTTACGGGAATGTGGGA
TTCCCGTAAACTTGTTGTGTGCTCGATGCCGCCCGCCCCCCCCCCTCAATTCGTAAACCTCTCCCAACCACCTACTTCGAACCAAAGTCCCTTTGTTCAG
CAGCTAAGTAAACTGCGCCTGACACATATCGCACTTGTGGCTGCCGTTGGCCTCCTTACCCAAGTTGACGTTGACTCGGACCCCGCGACGATAAACTCGA
AGCCAGCCATCTCTGACTTGCCAAGCATTGATCGTTCGCCCCTCGCAGCAACAGACGTCCCCAACAACAGGCGTTTAAGAACTGACACAAAGATGGACAA
TGGCGAAGAGAGAGGAATCAATTTCGACAAAGCCAAGACCTGGATCATGCCGGAAGTCTCTAAACAAAAACTCGAACGCTGGCTAACGAAAGAGAAGCCT
GTTGAAAATGTCTTTACGCGATTGCGACTTCGACAGGCAGGCGATAAGCTGCTCGGTGACCCCCAGTTTGCAGTTTGGGTGAAATACGTCGACGATTTAA
GCAGCAGGAATCCCAAGAAGACAACGCTGACGATCCATGTGCTGCTTACACACTACAGCGACGAAGCTCTGGTTAAAATGGTGGCAGATGTGAAGACCAT
CCCGGAAACCAACACATTTGCAATCAGGTTGCAGAACGAGCTAGCCGAGTATTGGTTGACGAAAGGGAAAACACCAGGCGGCATCTTCACTCTGCTACAG
CTTGACAAGGCCGGAGATGATATTCTGACAAGTCAAACGTTTAGCATCTGGAAAACGTTCTTGAACACGTTCAACAAGGCGAACTCTGGCAAGACGGTGA
GTATGTTTGGAACGTTGATGAATCAATACGGCGAAATCGGTGTGTCAAGAATAGTGGAAGCATTGAAGGTCAAAAGTTCAAATTACGTCGCCAAAACAGT
TCAAGCGAGCAGTTCCAGCGCTGGATAAGACGTGGAGAGTCTCCGAACGCAGTTTTTGAGCTGTTAAAGCTGGACGAAGCAGGTGACAACCTCCTTGCTA
GTCCGTTGTTGGATACATTCACCAAGTACATGAGTACTTTCAACATGCAGCATGGGGAGCAGCAAGAGACTTTGATCGCAGTGTTGACCAAATACTACGA
CGTACCAAGCCTTCTAGCCGCAGCAAAAATAGTTCCGAGCACATCACGTCTTGCCAATAAGTTAGAAGCACAGCAGTATCTGCACTGGCTGAAGACTGGC
TACGACCCCGAAACTGCCTTCATTCTGCTTGGACTTGGTGATGCAGGAGAGAAACTTCTCACCAAATCAAATTTCGCTACTTGGCTGAAGTACACTGATG
CTTTTCACGCTGACAACCCGGACACAACATTGAAAACCTTGAGTATATTACATAGTTACGCCAAAGGTGCTGGGCGGTTGCCCCTTTCGGACGCTGCTCT
AGCCAGAATGACGGCGATTGCAGAGAAGAATCCGACTACGATAAATGTTGCCAAACGAATGAAAGCTGTCCTGTTCCAAGGGTGGATGCGTAAGAGAGGT
CACAAGACCACTGACGACGTCTTCACCATGCTAAAACTTGATGAAGCCGGAGAAAGACTGTTTCAAAGCCCCATGCTTGAACTTTGGATGAAGTACGTGG
ATGGTTTCAACAAAGCGTTCCCAAAAGAGAGAGAGGGTATGAAGATTCTGACGACAAGCTACGACGACGCAGTTCTAGTGAAAATGATCGAATTGGCGAA
GAAAGATTCGAGTACGAAAGAAGTGGCCACCAAGGTCCAGAGTGAGATGCTTACTCAGTTCGCGAACGCTCAAAAGAATCCGGCGTATGTTGGCAAGCTG
CTAAATATCAAGGACAAGACGGATGCGAACTGGGGTATTTGGAAGAAATATCTGCAAGGCTATCAAAATTTACACTCCCCCGCCATGACGTAGGACGCTT
GAACAGCTCACAAACGCGTAGGATGATATACGGACGACAAACCTGGTATTAGTTGGAACAAATAGTTTGTTTCCTGGATGACTCGCTGACGGCGTCTATG
CACTGCACACAGTTAGGCGGCTCCGCTACGTGTACTTCTGAGCTGTCTGATATTGAACGCGGGGTCCCTGCCTAGTGCTAGGTTAGCCATATAGAGTAGC
CACCTCGCTCATATACCAGC