Description :
From Genome Similarity Track
Location :
Scaffold_57:17807- 24260
Transcript NameFunction/comments
Physo_137737reverse transcriptase

Sequence
6453 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTATGTAGCGCATGGTGGGCTTCGTATGCCCTCACCATGTCCGGGACGTCTTCGAACA
AGACGTTCCGCGGCTCCCATGTATCTCGGTTGGAAAGGAATCCTCTCCAACGGATACGAAAACGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTGACC
AACAATCTGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGTGGTGGTGGTGGGAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCGCTGGGTTCGGCGCTGTAAAGTATCCTCAGGTTGCGGCGACCTCC
CAGACCGCCTCGATCGTTCCAGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCGCTGGAGAGGATGATGGCTTCCGCCGAGTCTT
CTGCTTCGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGACGCGCATACTAGACGGTATGTCC
AGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTATAGGCA
GGTTTTGAGTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTTTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGC
TGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCGCGAAGTTGATTGCGTCCGAGCTGAACGAGTTCAGCTCGTTTCTAGCAGTAGGC
CCGGCCTCTGCGTTTGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCATTCTGCTTTTTCTCCTTGCTCTTGTCGGCGTCTGTGGCCTGCACAGACGCGT
GTTTCTTCTTTTTGCGCGTAGTCGCGGCTGACACTGTCCAAGTGTCAGTGGCATACTGCGGCTGCTGCGTTGTAGTCGTAGATCCTCCCCCACTTAAGGA
AGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGCATTCACGTAGAATGGTGTATGCCCAGTCGAGGCATGCACCGATTTGTTGATG
GCGAACTCTGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTATCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCC
CGTCCGTCTGTGGATGGTCTGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCATGAAGCGCGGGTCTCGATCC
GACACAATGTCGATCGGCATGCCATGGTGTTTGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCGCAACAAGATGTATCATCT
TGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCG
TGGAGTTGGTAATGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATAC
TGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATAATCGTACATGATCCTGA
GTCGCAGGTCCTGGTCAGTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACG
AGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACC
TTCACGTCGTCCAACAGTAATGACGTCGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGA
GCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATTTCGGCATCCGTTGCGAGATGTG
CGGCGCCTTCACAGCCGTCCCCAGCGACACGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGCGTAGATACACTCGGAACTTCGCGAGTGCGTACTTC
ATGGCAAGGCGTTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGGCGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGT
GCTGCATCAACGCACATCCGATTGCGAAGGCGGATGCGTCACACACAACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATAGGCGCCTCAGGCAA
GCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCG
TAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGAAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCT
TCTCAGGGCCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACAGGTATCTCACTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTT
GTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACAAGGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCG
AAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCC
ACTCCCAGAGCATGCCGCTCGGCGTGCTCACGGCCGTGAGAGGGGTATCGCTCTCACGCATGATGATCTGGTAGAACCCATCGCGCAGATCAAGAGCACT
GTAGATAGTGCTCCTGGCCATCGAATCGGTGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGA
ACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCTGGGACTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGA
AGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAGTCTCGTGCTGGATGCC
CTTATCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTC
TGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGGTCT
TCGTTCTCTCGGCGTCCGAGAGAATGCATAGTTGCTCGATGCGTCGATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAA
CTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTC
TCAGCCTCCGTCTGCCCGGCCGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTCTGCGGA
GCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGTCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTC
AAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTACAGCCCGGCTGTACGACAGCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGCCCGCACCGCCT
GCAGCGTCGGCTCCCCGAGCCGACACGCCATCTTTACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGGCG
AATCAAATTCACCCAAGCCATCGACTCCCAGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGC
CTCCACGGTTGAGGTGTGTGTCATCCGTGCCCCTTGAGGCCGGAGACTATTCCTGATTCGCTGATAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCC
TTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAG
CGCACTCTCGTGCGCTTCTCCGAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATTGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACG
ATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCACGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCA
ACATACTTCGAGGTATCTTTAAATCCTCGAGGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCGGAATCTACCAAAGCACGGAG
AAAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCCTGTCATCTTGCTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTC
CTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTGTTTGTCCGCGACGATG
CCCAGCATTGCCGCGTCGACCACCATCTCGGTGCACGGGTGCCGTGCGCTCTCGGGCATAGTGACCGATCATTCCTCAACGGAAGCATCGTACATTACTT
CCTTGTTGCTGTTGATAATCAACAGCCGTTGCAGTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGGTTGCAGCCTCGGCGCAT
TTGCATGCAGTTTAGCCTGCCTCAGACTAAACTCCTCCTGCATTGCAAGAGTAATCGCAGCTTCGAGAGTGCCTGGGTACTCACGGAAGAGATAGGTCTT
TACAGGCCCATCTCTCAGACCCTTCATGAACGTGACGACCTTGGTCGGCTCGTCTATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCTCTCTGC
GCGTAAGCATGGACATCGTGCCTACCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCGAAACTCATTTTGCGGAGGCTCAAACGCTTGCCTGAGCTCCT
CCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGATCAGAGAGTCGGTGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGT
AACCTTGGACAACTGGTCGACGATACGTCGAGCCGCGATGGGAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATAGTTG
CTCACGTTTAGCTTCAACGATTGTCCACGCGGTGCCGTCTCCGACGCCACCGCGGTAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAACCCCAGAG
CAACACCATGTTGCTCTGTCGGCGATAGCGTACGCAGCATCGCAGCTACTACCGCCTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCGCTCTGG
ATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAGGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGATAAGGTTCTCGGCTCCT
CGTTCGTACAACTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACGAAGTGCTACCAGTTGTAGTGGGCCTACCTTGGCTCACTACTAAGGC
TTTCACGTATGCGGACGTGTATGAGGAAGCGTACGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCC
AAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCT
GGTTGACAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGT
GGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACCAAGGTCGAGGAAGTG