Description :
From Genome Similarity Track
Location :
Scaffold_1164:1780- 2962
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1164-snap-gene-0.4Novel protein

Sequence
1182 bases(100 bases per row)
ATGTTCGCGTCCACTGTGAACGAACGTGAGACCGAGCTGATCCCAGTCGCGGGCGAGCGAATGTACTACCTACCACTCAGCTCCGACCACTACACACTGG
AGTCGGAATCAACTAGGATGGCAGCCCAGGCCAAGCGCGAGTACTGCTCCAGCTTGACGACGCCGGGCGTGACAACTCTCCACAGTCTCAACGAGATCGC
CGAAATGGTCACGAGCAGCTACGCCGGCACCAGTCGCGTGGGCAGAGAGCAGTTCCCGCCCATGGTCGGCGTTGTGCGCGTCAAGTCGCGCATGACGCAC
TTTGGTGAGCCAGGGAGAGCGAATCCGTTCCCATTCGTGTTCCACATTGTCCTCGGTACGTGCCCTCTCCTCAATTATATCTCAACAATCCTGCTCTCGC
CAGTCTCCTTGCTAATGATATAGCTCGGCTAACAATCGTGTGTCTGTGTGCTCATTAACATGACCAGTCGACTACACTTCCGCGGTCGAGATCGCGTTCT
TTGGCTCGATGTGTGCGAGATTCTTTTCCACAATCGAAGAAGGTGACCTGATCCAGGTGCGCGGCTACTCAGTCTCGAACACCGAGTCCGAAGAGAGTAA
CGCGGGCGTGGCGGAGCAGCTCTTCTACTTTGAGCACGAGTCTGAAGGACAAGTGCTTCACCTCCAAGGTACGAACCGCTTGCCTGGGTTGACTACATTA
CTACTGCTATACTAATGCGTGCGTCTGGTTTGTAATTCGTCAATGATGACAGCGAAATGGTGGAAGATGCTCGGAGTGACAGAGGTCCTGTGGAGGCCTC
GTGTTTGGGAACGAGTCACCAACTACAGAAAAGCAGTCTGCATGCAGCCACCGTCGCCAGCACCAATTTGGCTCGAGTGCAGCTTCGCGAACACGAACGA
GGTGCAGTCTTGGAACGCCCGGATCAAGCAAGACAATATCTTTGACTTCGTCGGCGTGCTCTCCTTCGCTGGCAAGATCTGTCGGCGGCGTAAGCGAAAG
CGTACTTCTGGAGACGATGACGGTGAAGAGAGCGGACCCGTGACAGAGTACCGATGGATCAAGGCTGTGAACGAACATTCTTCGACCGAGTTGACCATCC
TGCTCCACGACTGCTCGCAGCCTCAGCAATTCCGCAACCTCAAGGCTGGGGACACTATCATGCTCACAAAGCTGCTATGTGT