Description :
From Genome Similarity Track
Location :
Scaffold_113:178- 4210
Sequence
4032 bases(100 bases per row)
CCGAGACGGTCCATCCATTAGGTGGGCTTAATTGCGGGCCATCCCTTCTTTCACGCGATACAAAATAAAAGCCACACCTGCGATTCCCACCTGAATTTGA
TGTGGACGGGCATCTTCGTTGAGTCGATCCGCTCGGACCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCTGGTAGTATTTCTAGA
CTTGGATATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGATTACCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCA
AGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTCGCGAAAGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACA
TACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGATGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGA
TCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTA
CGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAAACAACAATTCTGTGTTTCCTTTG
AACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGC
CCTTGCCTGTCTCACAATCCACACATTCACCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCCGATCCGTTGGCAGGTCCG
ACCAATACCCTGATGTCCACCTTCTAAGCTAGCGTGATAGTGATGTAGAACGTCCTGTTGCAAGGTTTCTGGCATCACTAATCTCATCAATCCGTCTCGA
TCCCCACTGACTCGTTTCATAGGAGGACAATAGAAGAGCAAATCGTTCAGATCCACTGCATAATCCGTAGATATAATACTACAGGATTTGGCGTCCTCCC
GACTCAGGTCGCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGACCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTT
CACAAATGTTTCCTCGAGGATCTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCGTTTCTTGGATCCAAATACC
ACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCATGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGC
TGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAATTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGC
CGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCC
AAACCCAGAAGGAGTCGTCTATATACTCCGGCTCATTGACGGTGAGGCCTTTCTGCGTAGAGTGAGATTCTGGCTCGTAACAAACTTCACATTCCGGGCA
GTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGG
GATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGGGGTGTGATGCTCGCGGCCAAGACT
CCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACAACCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCG
ACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACTAGCAGGTTGTAATTCACATCCAACACGCGCAGGAGCGCGAG
TATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAGATCTCCTCATGTTCTTGAACCAGA
GCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCA
GTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTC
CCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCCTGTTGGATT
TTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGAATGT
AGTAGTTCAAACTTCCCAAGAAGGATTGCATCGCCCGTAGCGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTATGGGGTCCCAGGATCCC
CTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATC
GATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCAGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGA
GATCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTATCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGG
GCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTTTTCTTGATGATGATTACCACTGG
GGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGC
ACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTCCGACAAGT