Description :
From Genome Similarity Track
Location :
Scaffold_3489:178- 2366
Sequence
2188 bases(100 bases per row)
AGTAATAGTCTGTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGGCACCCATTTCTCGCCCCGAGTGACCC
ACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTGCCAGGTTTCTCCGGGCTCGGTCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTT
CGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCACCCGCCAGATCCAACCTCACTCCGGCTGGTACC
ATGAAATCCATCCCGAGGATGGCGTCTTGCCCAGCGAGATCTCCAACCCAAAATCAAACCAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGC
TCTCCCATTCGTACGGTACACGCCGTCACCAATCCCAACACAATCTTGGATCCGGCTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTGTCT
AGTATAGCTCCTCGGCACCACTATCTAGGAGTAGGATAGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATG
GTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCT
GCAGAGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTTCTCCCCTTTTGTAAAATTCGGGTTGGAGA
GACCTCGGATCTGGCCAATTCATCCATTTGGCGCAAACTAGAAACCTTGGCAACGGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTC
CTGCTACCTGCATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTT
TAACATCTTCTCGGCCACTTTTGGCAACATCCCTCGGTGCTGGGCTGGATCAAATCATTGGGCGGATCTGATGTAGAATCTTCCATCGGGCACTTGCCGA
CGTCGTGAATCTCGCCACACCCGCGACACACGTAAAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTTCTCACAGACCAGATGTTTCCAGCATC
CAGATTTCAGTGTGCTTCCGGGATCTGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTA
CGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGCTCGATCGTTGGATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACC
GTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGAT
CCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGT
CGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATTCACGTGTTCCCGCAGTACCTTGGATCCCCCCATCCTTGATCTTCAACTTGGCCCGTAGAC
CGGCCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGT
ACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTTCCCAGCTGCCGATACCAATTTCTGGCTGGTCCCGCTAGCAGATCCGC
AAAAGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGATGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTG
CCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGAACGATCCACCTGCCCCGGCTGCGGCTGTTGCTACCACCGCCGCCG
AAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTTCCTCCACTGACTCCATCTCCACGTCTCGCGCTCC