Description :
From Genome Similarity Track
Location :
Scaffold_3023:178- 1581
Transcript NameFunction/comments
Phyta_totarag15013hypothetical protein PHYSODRAFT_340298

Sequence
1403 bases(100 bases per row)
AGTCGAGAAGGACTTCTTGCCTTTAGCTGGTTGATTTGGGAGACCTCGCTCACATAAGTATCGGGAATGGGCATAGCTCATCTACGAATCTGAGCCTTCA
CCTGAAATCCTGGAGCGAGAAGAGAGGATCACGAGACAAGCTGAGTTGAACGCCCCGCCGACCGTAGAAAAGCAAGTATATCGATGGCCCGCGAAGCTAT
TGCTGAGAAAGAAGAGCGATGGTCAAGGTGCTGGGACACGGACCAAGTCTGAGAGGACTCGGCCTGAAGCCACAGTTTACGTGGTCAGTACGAATCCATC
ACCTCCTTTTCAGACTCTGAGACGTTCGAGACCTGAGAATCATAAAGCTCAGGTGGGAGTCATTTCTGGATGTCCGAGTAATCTACGGCTTGAGGAGAAA
AGTAACCCCCAGCCAGAGATGGTTGCATCACTGCAAGATCCCCGAGAAGATGATTCCGAAGTGGTGACCACCTCGAACTCAGTCATTGGAGCAAGCGATA
ATGCTCAGAGTGATCAGCGTGAGTTGGAAGAAGCACTCGAACATCACTCGGTGAAGTTTGCAGCTGATCCAGTCTTTCAACTGCATGAAATGTCCGCCCG
CTGCATGACGGTTGGTATCACAGATCTGGACGAAGTAGCGACTGCGTATTTCCATGAAGGTCAAGAGCTTCTGAGTAATCTCCGAGATCAATTAGCAGCA
CTGCCTGAGCTGAGAGATCTCAGTCCTGAGGCGGACCTCGCAAAGGCCTAAGTTGGAGAACCTGGAGTCACCACCCCTGAGATGAATGCCCAAGTACAGA
AGATCCTGGAACGGCATCATTCCTGTATTCTTGGTGATGGTAATGCAGTCCCATCCCCAACCAGAGGTGTCGTCTGTGATTTGGATGTCGGAGATGCTAA
ACCTGTAGCTCAACGATCTAGGCAGGTCTCTCCGCATCAACTTCAGAAAGTATACGATCTGCTCAAGAAACTATTGGAAACTGGGCTCGTGGAATACTCG
AACTCAGACTGGGCATCACCGATTGTCAttgtggtgaagaagaacggtgTTGATATCCGACTCTGTATCGATTATCGACTGGTGAATCAGCTGATCAAGC
TCATGCACTACCCTCTACCGTTGATTGACGATTTGTTGATTGGGTTTGAAAGTGCAATGTGGTTTCTGAGCTTGGATATGGCTAGTGGATTCTGGGCAGT
GCCGATGACGCTCCTGGCGAAACACATCTCAGCTTTTATCTGTCCGCTTGGTCACTTTCAGTGGACGCGTATGCCGTTTGGGCTGAAAAATGCACCCCTG
ATCTACCAGCAGATGCTCGATAATTGTCTCTGGGGATTCGTGCGACTCTCACCCAGCGAGGAAGCTCAAGTGGATTCTGAAGTGCTGGCGTTCTTGGGAA
TTG