Description :
From Genome Similarity Track
Location :
Scaffold_3318:178- 1514
Sequence
1336 bases(100 bases per row)
CATGTGCCCACACGACATCTTGGTTTTAGTATGCCTGGCGAGCCACTACACACGAGATCTTGTTTTTTGTATGGTGTTCTTTAATTTGATTATTATGAAG
ATGAAAGAGAACCGTTAGAACGGGTATGAAGGGTGTTCTAGGGGTGCTTTTCGGTGCTCTTTCACGTGGACATATCGCAGCATGCGACATGTCAGCGGAA
CACTGTCTAAATTAATAAATACTGTTTTGGCCGATTTCTAAAAGCGTCTATAAAAGGGCATAAGTGCAATGACTCGTCTTTGTAACCCTGCGGCCTAGGC
GTAGTTTTTCACGGGGAATCCGAATATCAAAGGTAGATTTATGTACAACATGTACTTTTTTTGCAACATGTACTTTTTATCTACGGGACATAGACATATG
TAAAAACACACGGCGGAGCCGTTCCCGCAATCAGAATTTGTCTAACTCTTCTAGATAAAAAGTTATTCAGCGAAATGTGAGACTTTGTTTGGCATGCTCT
TTTTTTAGGTGGTTTTTTCCGGTTTTATGTGCCGCCCGGCAGATCTGGCCTGCAGACTTTAGCAGAAAACTTGGCGCATGTGTTCGCACGACCGCTCCCA
AAGTTTTACAAGCATATCTCCAGTAGTTGCTTCGCAATGATTTTTTTAGTGACGCCAAAAAACGCCATTTTCGCGGAAAATGGACACCTTGGACGGCCAA
AATCACCACTTTTGGCCATGTTTGGCCCTGCACATCCAGGAAGCAAATGAGACTGCTCCGTATAAAAACTGCCCTAGGGGTGCTTTTATGCGCGCATTCC
CGTGGTCAAGTCAGATTTTGGCTAAATTCAAATGCCTTGTCTATAAACACTTTTTTCGACCTAAATTTTCACCTGTTCTCTGACCCAACTCCCACCGGAT
CGAGGCGTACGGCACGAGATTGATATCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATAGCCTCTCTCGCGCGAGCAGTGCGAGGTCATCGATGCTT
TCTTCACGAGAAAGCGTAGGGTCAGGACATGGTGTCGGGATTCGAGATACGCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCG
TCTGGTTCACCTTTTATAACAAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCCAATCCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAG
CGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATG
CTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGTCT