Description :
From Genome Similarity Track
Location :
scaffold_15:17795- 19626
Transcript NameFunction/comments
Pl_112295conserved hypothetical protein

Sequence
1831 bases(100 bases per row)
CGTCGAATCGCAGTCATTTTTCGTTTAGCTTTGAGTCACCTAGTTACCATGAATCTCGAAGAAGGAGTAGTGAAGCAGCGTCAAGCTGTACCAATTCCTA
GCCGACGACCATGGGCTTCCTGGCGTCTCGTTGCAATTGCCACCATCGGTGCCTTGCTCGTCGTTACCCAATTGACCAACTACACACACCACTTTCACGC
TCATATCGCCAAACATCGAATTCTTCGCAACCTGCAGGAACAACCAGCACTTCGACTGACCTTCGAACTCAAGCGTAAAGCCATGTTTGTTCATGGTGCC
TCGACATTCGACGTTGTTGCAGCTCCAGCACCAAAACGTTCATCAGATGATAGAAGTATGGTGTACAACGGCATGGCGTCGTTCGAGAAGGATGGCCACA
CTCACGAATATTCCCTCGTGGATGGCACGACGTACTACACACGTCGTTCTAATGACCAACCTGTATCACACGGAGACTCGGGATGTCTGCCTTCAGGTTC
GGTTCCTCCAATTGAAAGCGTACTGAATGCCATTCATGGAGCGACTACCGTCACTGAGCAAAATGACAAGTGTCCCGGAGGTACCGTGATGGTGTTCAAG
TTCGCTGGTGACGATTTCGTGCTGTGTTCGCGTCAATCGAGTATGCCTGGGCTTCAGGACGACGGATTCCAGATCTTCGGCAAGGACCTAAATATTGGTG
TGAAGTACGAGCAAACTGCGCCGGCTATTGTAGCTCCGCACGTCTCGACAGAGTTATTGGCCTCGTGTGGAAAGGTCCCATTTGGTGATCGTATCTCTCC
GTCGCTGCCTGCATTGCTAAGCCGCTCGTTCTCCGAGTGGGGTCACCGTGCTCTGCGTGCCGAAAAAGCTGAGGGTCTCTTTGACAAGGTTTGGGATCTC
ATCACGGATAACACTTGTGGTTGCAAGGGTGCTAAGCGAGCGTGTGTGTTCGTTGCCGGGTTGAGTTCATACGATGACCACGGTCTGACCGAGGACGACC
CGGAAGGCTACTTTGGTGGTGAAATCGGCGATCACGCGCCGTGCTGTTCAAGTAGGAAGTTCATCACGTTGGCTACGAAGAAAAACTCGTGGAATGACCC
TCTATTCCAACAACGCCTGGTAGATTTGCTTGTGCAGGTGAGCGGAACGAGCGATCTGGCTACAGGCACCATCAAAGACACGATCTACATCGGCCACTCA
ATGGCGAACCTCATTCTGGCCGGAGCTATTGCAAGCGGTAAAGCCACCTTTGACCCATCGTCGACTTGGGTCGCAGCAAGCGCTCCAATGGAAGGCAGTA
TGGGCTCCAACTACATCCAGAAATCGTGTAACGGAGAAGAAAGCGGCTTCGTTGCAAGTGTCATTGAGTTGTTGGGCAATTGTCCTGCGAACACCGGTGA
AACATCACTTGCATACCAGGGCTCGAGCTTCTCATCGCAGACTTTGAACGACGCCTACGCTGGTGCACAAGCTGCTTACGCTAAGAACGTCGATGCTGTC
ATGTGTAGCAACAGTTTTACGGGCTTGGTAACAGCGAAGGCGGCTATCTACGCGCTCGCAGGTAAAATTTTACCCCACCATTCGTCTGAAAACGATGGTA
TCGTGGAATACGGAAGCTGTGCTTTTGGACTTCCTCTTGACAGCTTCGACAACTCGTACAAAAGTCCACGCTATGTGGCTCAGCTCAATCACGTGGATAC
ATCATTCCGGAACGGCGACGGAATGTTTAGCGACGCCAAGAAACCTTTAAAATGGTTCGAGTGCCTTCTGTAAAAGGGAAATAGTGGACCAGAAGCACAT
TTACCAGTCGTGGAGTACAGAACTTTGTTGT