Description :
From Genome Similarity Track
Location :
contig_50:177806- 184556
Transcript NameFunction/comments
g10371.t1hypothetical protein
g10372.t1hypothetical protein

Sequence
6750 bases(100 bases per row)
ACGTCTTGAAAGCACTCAGAAGATTGTTATTAGGTGCCCGAGATCACGTCTTGAAAGCACTTGGAAGAGTGTGGTTAAGGTGCCCGAGGAACTACTCGAG
GTCACCAAACACGTTAGCCCACGTCTGCTTGGCCAGAGCAGGAGTCGACTTTATTCCTTTTCTTTAGATTCCAGAATGAGCTCGCTCGCTCACCCACTAC
TCAGGTTCGTACCCATACTCTCTGCTACCTGGGTTCACTACTGTCTCGGTAATTGTTGAAGTTGCTGCTGTCGCTGGTCTGAACCCAGGTTAAGGCTGAG
GCCTATTGAACTACGTGCTTGCACTGGATCATCATCTGTACTCGATACCTCACGAGACTTCATGGGAATCTCGTGACACTGGACCACTTCAAGATGCCCA
TACTTGGCGGCGCTACGCAACGCATTCGCCGGCATCCGCTCGCTCCGGTTCGCGTAGAGCCATTGCACAACGACCAAGTGGCCGTTGGCCGCTGCACTGC
TCATGGCGTGTTTGGTGCATCCTTCTGGTCGGTTTTCGTGTAGGAAGCGCACAACGTCGAGGTGGCCCTTCCCGGCAGCATAATCCATCGCCTCCGTGCT
GCAAGGCTCACTGCGGTTGTCATGGATCCACTGCACCATATCTAGTCGACCACTGGCTGCTGCGTAGTTCATGGCTCGATACGTGCAACCTTCACTGCGG
TTCGCATGCAACCACTGCATAACAGGGAGATGGCCATGTTCCGCTGCCGTGTCCATGAGGAATCGTCCACAGCGACTCGATCCTTCGTGGCCTTCACCCC
ATGAAGTGCGTCCTGGGTAGCACTCGTTCAGCCATTCGAGGACGTGCACGAACCCTCGAATGACAGCGGCCGCTGCCATGTACTGACCATTGGCCCAGTC
CGGGTCGCGAGCTGCTGCATATTCCAGTGCTCGTCTCGGCAGCCCCAATCTGCACGCACGCCCAACTTTCTTGCGCGATGAGAACGGATCTAGGTACTGG
TCCACAAGCGTCACGGCGTGAGACAGCGATCCCACGTTGCGCTTCGAGAGACATTCGCGACAGACAACGAGAGCTGTCGTGAGTTCTGGGAACTCCTGTC
GCTTTGGGGTCTCTATCATCGCCACGTGTAAATCGAGAATGGAGCTACAGGCTGAAGTGCCATCTCGGTGGAGTCAGCAAGAGGCTTCATCCGTTTTTGC
AACCGATCGAAACGGACATCGCTGGATGGATTTGCCACACTGACGTTTACTGGCGAGATGTGGTGGCTCAGCAATGTGCTGTCGCTGCTGAGGGTGAGCC
GCACTCGCTCAAGTTCGTCAGGTACTCAAAGAACTCGGGCAGGTCGACAGTGACTCCATGTTGTGGGAGACAGATATGTTTGCTTAATGCGCTGGTAAGA
CGGCTTGGTAGGTTTGTCCACTGTAGTGAAAGCCACGCTTGTTAGTTCTGGATCTCGATAGGGTGATTGTTACATGTATTCTATTGTGCACTTCTAGTTT
GTCATGTTGCGGCCTAGGAGGGCGAAGGCGCTAGTCTAGATGGGTCTCGTGACCGCTCTCCGAGGCTCACGACATCTCGCAATGCTGCTACGATTTGTGA
GCTTGCCGGGACGGCAAAGCGCCTGGCGAGATCATCACGGTCAGCGCACGCAGCAAGTCGCCCGGACGGCAGTTCCACCACGTAGGCCAGTACGAAGGCA
AGCATGGACCGCAGCCGAGACGCTGCAGTGTCATCGCTCAGGCTTTGTCCGATAGACTGCACAGTCACTTTGAGCACCGCCACAAACTTGACCACAAACT
GAGTGAACACCTTCTCGACAGTTTCAATGCGTCCCTCCTTCATCGAGAGCAATTCGCACACAGCAAACACATCCAGTGACGATCCCAAAACCTTCAGGCA
GAATGTGGTAGCTTGCCAGACGATATCCCACAGCACGAGACCAGTCATCTTCAACGGGGAAGCTGCTGTACAGCTCAAGTCACCAGCCGCGACGCACTCG
GAGAAAGAGCTCGTGAACTCTGACAAGCACTGCAACAGTCCAGTCGTCTGGAGCTCCCACTCTGCAACACTGGGGATCTTGGACTCACTGCCGGCGTGCT
TCGACATTGTAGCAATGCATCTCTTTAATGAGCGGTACCGCTGCTCTTCTTCGCGTAGCTGTGTCTCTTCTTGGTTGGCAGCGCCAGTGACAGGTGCTAC
AATCGCAGCCGTGGCAGCTGTCGTAAGCAACGACGAAGAACGAAGAGCGTTCACCGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTC
CTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAAC
TGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAAC
AGTTGACCTCACCTCCTGACGAGTCTTCGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCA
ATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCA
CGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGT
GCCGGGGAACGCCGTTGCCGGTGACTTCACTCCGGAAGTGGCTGAGTACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCA
TCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTA
ATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTCGCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGGTCTTC
TCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACGTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGT
ATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGAT
ACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCACGGAAT
GCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCGCGCCGCCTCTAGTGTGCTGATTCCTTCACGC
TCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCGAGGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATACCCGAGGAATTTTGCCA
TCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTG
TTTGACAAGCTCGGAGAACTCGTAGCTATCACAACTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTT
GCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGGTTTCCATGGCGAATTGTTGTTTCCCTTGCCCGCCAGTCCTG
TTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGTGACTTATTCAAAGGCTTTTGGCTTGAAAAGCGCCGATGCA
GCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTG
CAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAACTCCCGCGCAAGCGCAATAGCTGCTGCTGCCACA
CCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAGGA
GGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAG
CTGACAGCCGACCCGAGCACTTTCAGCCACTCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCG
TCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGT
GGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATA
CAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTG
AAGTCCGACGACGAAGCTCCCTTCTTCACATTAATTGTCTTCTTGGCGGGACTCTCCTCTTCCTGATTAGACGGGGTCTCCCTCTTCTCCTGCTGGATAT
GGGTCTCCTGTCGTAAATGGGTCTCTTGGTTCGATGTCTTCTCCTGCGACACTGGAATTTTCTTCTTGGGTCTCACCTGCATCACTCCTTCCTTAATCAC
CTGCTGTCCCCACACGTTGGTCCCGCCCATCCTCTTCTCCAGTAGCGACCTCTTGGCCCACGCGGGCGGGCGCGTGCTCTCTGACGAACCCAAAGGAGGG
AACGCGATGGTTGCAGGAACCGGACGCGCCACCGATGTGGTCGTCAACAGGGTCGTCGTGATCCTCCGCTTCACGGGCTTCAATTGCGGGAACTCGTGCT
CGAATGACTGCAACGCATCCTTTTCGATCTCAGGTTTGGTAGTTGGACCAATTTCTGGTGCGGAATGGTCCTCGGAGACCTGCGTGTTTGCGTGCAATTG
CGTCTGCCCGTGCACAAAGTCCAGGAAAATGGGTACAAAGTCGTCCACGCGCACGCGCCCGAGCGGCAACTGGACGGAGGCGCTTCTGGCGCTTGTGCGG
GCCTCGCATGACGCCAGGGGCCGCGCGGGGTCGACGCAGTGGAATTGGCGCACACTGTGCTGGATGCCGCGCAGCTCCACGTCCGAGAGACCGCCCACGG
CCGCCCAGAGAGACGCGCCGTCCGATGAGCTCCGCGCCATTTTTTCGAAATTGGGCGGTTGCGATTGGTGGAAAAAATAGCGGGTGGACCTAAAACGAGC
GCCCATTTTGACGACTTTTTGACCTGTATTTAGCAAGCTGGTTATGTTATTAGGGTTTGAGATCTTTATGCGATGCAGGCATGATAATATTTATTGAGAC
GACAGGTTGCTCTATCTTACTTAGGAAGGCAAAATGGGCGATTCCGGTTACCTGGCCATTTACTCACCCAAATGCATGCAAGACCCACTTGCAGTTTAAT
CTCGATTTGATGTCCAAATTGTGCTTCCAGTGGGTATTGTGTGGAACGAAGGTACCGGTGTGCGAAGTCATGGAAAGGGTGAGCTGAACGCACTCAGGAT
CGATTCGAGTAGAGAACAGGCATTCGGGCTTGCTTCGGTCCGAATGCATGACCGAGTTGTCGCCCGGCATTATTATACTTCGAAGTACATGTATTATTGT
GCTTTGCAATCGTTTTGGGAAAACGAGATAGGATTTGGTGGATTCAAACGTGCCATGTGGTTGATTTACGATAAACCAAGGTGCATAAAATCGGGCTGGC
GTATATTTACGCTAAAACAGCCATTTTTGTGCTTTTGAAAGGGCAATGACGGCAGGGTTGCAACAATTCAGTTGTCAGCCCCAGGCATCGTTAAATCTCA
CGCCAATCGAAAATGCGATCGACTGCATTACTAGGGCCATTCGTCATAGTCATGCATGTGCCTGCAGCACATGACAAGCTTTCAAGTGAGGGGAAACTGC
AGAGTTCAATTCGATGCATCCTCCATGCAGATGGAGTTAGCTATTTGTATCGCTTGTAACACACTCTCACGAGAACTGCTTGCCATATTTACCTCCTAAA
AAGCCCGCTAAACAACTACAACGCACAATAGAAGTATTTTAAAATTTATTATTACCGTAATCGCATAGGCAAAGACATCTCCACATCTTCTAGCACAGCA
TCTTCTTGAACGGTCGATAATGGCCGCTCATCTTTGATCGTTTGCGCTCGTTCGGAAGTCTTAATGTCATCCAGAATTTCAACGTCTTCTTCCGACTGAA
GAGAGTCCGAAACTCGATCTTCTGCCGGGGGCTCAACCTTCACGACGTCACCCTCAGACGGGCTCATCAGACGTCTCATCAGACTCTTGCGAGATGGAAC
CATTTTCGTCGTCCGAACCGGATTCCGATCCGGACCACTCGGAGTCTTCT