Description :
From Genome Similarity Track
Location :
Scaffold_43:177806- 181610
Sequence
3804 bases(100 bases per row)
TGTGTGTCGCCAACTAGGCAAGAGGAAGGAGCGACACTTCCTTCCCCTCCCTCTTGCCCCCTTCATTGCTGGGACGTTCCGGTGGGAGTGGCTGCTCTCG
TCGAGCTGGCGTTTCCCGCCAGACTACGAAGTTGTGCCAGCTCTGGACAATTCGACATCGAGTGTCCCTTTTGCATGCAGAAGAAGCACTCTAGTCCACG
ACGCCCTCCATTCCGATTATTGCTAGCTGGCTTGGGCCAGTTACACTCCATCGAATAATGTCCGTCTCGCTGGCAGCGATTGCAGCGTCCTTTGCCTCGC
GGACGGTTCTCCCTACTACAACCCTTTCGCTCGCAACGACCGCATACGATCTCGCCTTCAGTCGTTCGCGTGTCCGGTCCCTGTCGGACATTCAGCGGTC
CAAGACTAGCGTTCCCGTTTGAAGCTGGGACGCTGGAAGCCTGTGGCGCTTGAGGGACACTCGGAGCCACGACGTTAATCTGTCCAAGCTGCGTTCCAGA
GCCCTGTTGGTTGTTCAACATGACCTGATTCATCAATTGCAGTTGCTAAAGCACTTGCGACTGAGTAGACGCCTGAGCGTGGGTACTCGTTGACTCCGTT
CCCTCTCCGGCGAGCACGTCCTCTTCTTCGACAGACAAGTGCTGATTCTTGTACAGCAGTAACGCACACGCTTCCGGAATGGACGCTACCATACTATCAT
TCAGGACTGCTCTCATCTGCTTGTTGCGCAACCCATCCATGAAGAACTCGAATTGCATGCGTTAGTTTAGAGCTTCGCACATCGTCGAAATTCGGTCGCC
CCATTCTTCGGCCGACTTGCCGCGGTTTCTCTTAGCGTCCTTGAGTCACTTCCAGAGTTGCGTCGGAGTCTGACAGATAAAGCGGTTGTAAAAACGCACC
CTTAACGTCTCAAAGCTATCAATTCTCGAGTTGTACCACCATTTCTGGCCCACTTCGCCTTTCAGGCATTGCTCGAAGGCCGTAAATCTCATCTGGTCGT
CCATGCCGTAGGTGCACTTCTCGAAGGAACGCCAAAAAGCGGCGGCTCTCTCGCTCGTGGCCGTGTCAGAGTAAAAAAGGAACGATGACCTTTACGGCGT
TCCTCAACTCGGTGGGATTCCCAATGTTAGGGGCGTTCCGATACGAACGGTCTCCGATCGTTGCCGTTCCATATCTGCCTTCCTGGCCACCGATAGAGTT
GGCCATCGGCTCGTAAGGCAGTCCTGAGCTCGTCGGGTTCCTCCCACTCTGTCTGTCGTCGTAGCTCGGTACTCTAGTACCAGCGTGCCCGTCAAACACC
CTGCCAGAGGTGGCATGTCGCCCACCCGCCTCCCAGGTAGCAGACGTTGGAGCCTCCGAGGATACCGGTGCCGAGGTCCAGGCGGGTCGCGTTCCATGGG
CGCGCCATCCAGACGTAGGCGTCACTGGAGGTTGAATAGGAGAGTAGTACGCCCCGGGCAGAGGCGATCCTGCCCCTCGACTGCTCCAGCCAGGCTGAGG
CGATTGGATTGAAACGCCTCCATACAAAGGGATCGCCGCCATCGGCATCCCTGTCCGAGTCGCAGCTACTGTTCCCGGAGTCATCCTTGGGCTCGTGGCC
TCTAGGCTCCGGCGGTCTTCCATTGACGAGGGCGGAGATCGTGCTTGGCGCAATCCTCCCGACGCATCGTTCAGCGAGAGGCCACGGAGCGCTTGTTGGA
AGGAGTCGATTAAGAGCGCTTGGAGGGTCGCGTCTGTGTCTCGCGTTCCACTTCCAACAGTCGATGTCACGGTGGACCGAGTAGGGCTCTTCCTCTCTCC
TCCAGTCGAGACGTTAGATGGGGCCGCGGTCCTTGCGTCCCTGGAGCGTTCGTCCTCGCTCCTTCCCAATCCTGGTCCTTGCGGACTAGCGGCAGCCGTC
ACGTTCCTCCCTTCTCCTTCAACAGGTCCCAAGGAAGGGCGGGCTGGGTCAAATGTGAACGCCACGCCGCGTCGACCTCCTGGAGCAGCAGCCGTAGGCT
CAGCTCGCGGGTGGGACGCTGCGCCGGTCAGCTCACTAGGAGCAGGCTGGCTGGCGAGCTACAGCAAGAGATCTTGAAACTGAGCCCGACCTCTGGGGGT
CTCGAGCAGAGAGGTAATCCTCTCTCTCGTTCGGGGAAATGCGAGAGCCCCGTCGAACAGATTGTCATCGTCACCTTGAGCCGCCTGTGCCTTGTAGCCT
TCAGCCGCTTGCTGATCTTGACCTCGCGTTCCGTGTTCCGCTTCGACGTGTTCTCTCTCTCCGATAGGAGGTTCTCTTTGCGCGTTCTCAATCGCATTTC
CTACCTCACGCGCCGCTTCTCCTTCCTCTAGAACTTCGAAAAAGGGCAGCGCTTCTTCGCCCAACGTGTCGGACAGGTCGCGGAAGCTCATAGCGTACCT
ACTGTCCCTCCTTCTTGTTCAGGCGTTCCGTTGCCTTAAGTCTTGTAGCGCTCTCCTCCGCTCTTACATTCCTACGATTTTTCGGTAAGAAGATACCCTG
CTTCTCCACCAAATTGTCGCGGTATTCCTCCTTGATTGGGGTCGTGTATCTTGCAGACCGACCGTAGGAACTTTTAGCGTAATAAACGTAAAACAAATGT
ATTGATTGTCTTCTCACTTACTTGTGAGGTAAACACGACTGAGCTGCTCTCCTCGATGCCCACGAGAGAGAGCAGCTCCCTACACCCTCCCACGTGGCGG
TCCACTCCAGATCTTGAAATCAGCCGTCGACAGGCGTTCTTTTTATGCCGGGAGCGCCGACGTCGGAGGCGAATGACCCAGCTGGCTAGACGTGGTGCGC
TTCACCTGAAACGCGTTGAGCTTCTGAATACATTCGGCGAGAAGGTCGAGTCCCTCATTCAGCCGTATACCGTGACAAGTAAAGAGCCCCAACAAGGATT
TGCTACTACCAGCTGCAATCTACCGATTTACCAACTACAAATTTGGGATACATCGTTGATCCACCGCAAAATAATCGCATGTTTGTATTTGACTTGTATT
CTCCAGCGGGAAACCCAAACTTAGTCGTAGCTAACAATGATGTCTCTCCTGCTCAGTCAATATGCAGCAAATATTAAAATAGACACAGCACTTTTAGACG
TTGACGCCGTCGAGACACCAGTTAACATGTGAGCTCAACGTTCCCAACAAAAGACATCTGTCAGCCGTAGGTGCATTTGCACCCACTATATCTGAAAACT
CTGGAAAATGGTGACGTGTCGTGTCTTCTAAAATAAATTGAAAAGTGATCGTGTTCATCTCGTTATTTAGTTTAGTTTCAATAAAACAACCTTATCTTCA
TGCCCGTCAATTCGGGCACGTCCATCCAGAGCTCATCATTCTACGCCCACTGCCGTCACTCACTTGGCTATCCTTCTAATTAAACTCTTTCATTTTATGA
AAGGCTACTCGAAGAAGGGAAACCCAGAATTAACCAATTAAATTAAATCAAATTATGACAGAAGCTACAATAAAAAAGCCACGGGCAAGATCAACGAGCC
AAGACGCGGCTGTGCAGGGCTACTCGACGGCCGGGTCCAGCGTTAGCGACGTTTTTGGGGTCGAAGTAAGCTTCTTGCCCATATACTCGGTCACCCGACA
CGCTTGCATGGCTAATCTTTTGTTTACGTGTCCGGGCGCTACTGTGTCCACGAAGCCGCCCCACAACGTGCAGGAAAGCTCCTTGTTTGTAGCATCGGAG
ACGACAATTTCCCGGCATTGCGACGGCCGACCCTGTATCGTGCGATCTTTTGGTGAGCAAACCGTTTTTATCGTCGCAACCACGCTAACATACACCCCAA
CATC