Description :
From Genome Similarity Track
Location :
contig_60:177802- 203728
Transcript NameFunction/comments
g11176.t1RAW43669.1 Polyribonucleotide nucleotidyltransferase [Phytophthora cactorum
g11177.t1hypothetical protein
g11178.t1hypothetical protein
g11179.t1RAW43711.1 hypothetical protein PC110_g149 [Phytophthora cactorum
g11180.t1hypothetical protein
g11181.t1RAW43720.1 hypothetical protein PC110_g143 [Phytophthora cactorum
g11182.t1XP_008907637.1 AGC protein kinase [Phytophthora parasitica INRA-310

Sequence
25926 bases(100 bases per row)
TCAGGTCAAATGTTTCTCTTTATTTCTGTTGTGTGGACTCTAAAACACCAAGGAGGAGAGGTGGATCTTCCTTGGTAAAGTAACTACCTACTTGGACTGA
GTGCGCGGGCGACGAGCGGTCTTGGGACGACGCTTAGAAGGTGATGCCGAGCGACGGTGGTGGCCATTGCTCGCACACGTCTCAGAGTCCTCGGAGGAAG
TTGAGGCGTCCTCGCTACCGTCTGCACCCAACAGCACACGACGGGACATTTTGCCGGAAGCACCATCCTGCAGGCACTCGAACTCCATCTCTTGGCCCTC
AGACACCACGTCATTGATATTGCTGATCTTGTCGCGCGATAGCTCCGAAATGTGCACGAAGCCACGCTGGCCATCTGCAGACTCAAGGATTGCTCCAAAG
TCCATCACCTGCGTCACACGCATTGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGCTAGAGCCCTGGTTATCATTGTCACGGCCGTTAT
TGTTGTTGGCATTGCTGTTGTTACCGCGAGGGCCAGCGTTGGCAACACCGGCAAGTTCTGTTTGAATCCACTCGCAAGCTTTCTCCGCGCTTCCGGGTGC
GCCCACGACGCGAACAATTCCTTCGCGGCGATCCACGATGCTCACCGAGACTTCGAAACGCGACTCCAGATCACGAATGTTGCTGCCACCGACACCAATA
AGTGCACCGATCAAGTTCGTGGGAATAACGCATTCCATGCTCACGTTCGGTAGCGAGCTTCCACTAGTCTTCAGGTGCTCACGAGGCTCGGCGAGTTCGT
TGCTCATGCGACGCAGCACGTGCAGGCGCGCCTGCTTGGCTTCACGGAGTCCCTCCTTCAATACCGAAAGCGGCACGCCCCCAGGAAGCTTCACATCCAG
CTGAAGTGCCGTCACACCGACTGTCGTGCCTGCCACCTTGAAGTCCATGTCACCGTAGTGGTCCTCCGATCCAAGGATGTCAGTAACCAACTGGTATTCA
CCCTCTTCGATACGCTTCTCCTGGCCAGCAAAGGGGTCGCCAGCAGTAACCAGGCCAATGGCAATACCAGCCACAGCACGACGAACGGGGACGCCCGCGT
CCATGAGCGCCAATGAGACGCCACATACCGTCGCCATAGACGACGAACCGTCTGAACCAACCACCTCCGACGTCATACGCACAGTGTAGGGGAATTCGGT
CACCGACGGCAGAATAGGCAACACAGCCTTCTCAGCAAGAGCACCGTGGCCGATCATGCGTCGGTTGGTGCCACCCACACGCCCAGTCTCGTTCACGCAG
AAGGGTGGGAACTCGTAGTGCAGCATGGCATGCTTGAGAGACGTAGAAGCATCAGGTTCAGCCTGCTCACGCGCCTCATGCAGAGCACCACGAAGGCGGA
CACCACGTTCGAGAGGTCCCAACGTCACGGAGCACAGCGTCTGTGTTTCACCACGTGCAAACAGCGATGAACCGTGTGCCATTGGCAGCACATCAGCCTC
CATCTCGAGCGGACGCACGATGCGAACCGAACGACCGTCAAGCCGCACGGGTTTGTTCTTCTGACCCTTCGTCTCCTTCGCGATGGTCAGAATGCGCTCA
CGAAGCACACGCTGGAAAGTGTCGTGAGCAGCACGCTGGATGGCAGCATCGTCAATAGGAGGTGAAGCAGCAGCAAAGGTCTGACGCATGCCATTCAGCA
TCTTGCTGTAGACTTCGCGCTCTCCCTGCTGGCGAGCAATCTTACCAGCGCGACCACTTGCAATCAGGTCCTCGGCACCCTTGCGCCCCAGCTCCTCCGC
CTTCGCCCAAACCTCCGGCGGGATGTAGAGCGACGAGTACATACGCTTGCGCTTGCCGTGTTCCGCCGCCAGCTTCTTCTGCTCCTCAATAGCCGGTGCC
ACATGCGCATGCGCTAGGTCCAATGCCTCGTCAAGACGTGCCTCCGTCACTTCATCACCCGAGGCTTCTACCATCACCGCACGCTCAGCAGTACCAGCGT
ACAGCACATCAAGCGTCGCGGCCTCACGCTGCGGCGCCGTAGGGTTGGCCACCAGCTGGCCATCCACCTCGACAACACGCACACAACCCACCGGTCCGTT
CCACGGAATGTCGGACATGCCCAGCGCCGCCGACGTTGAGTTGACAGCCACCACGAGCGGGTCGTTGTTCGGGTCGTACGACTGCACCGTGGCCAGCACC
TGCGTATCTTCACAGAAATCGCGCGGGAACAGCGGGCGGATGGCGCGGTCCACCACACGAGACTGCAGCACCTCCTCGTCACTGCCAGTGAACTCGCGGC
GCTTCAGGTTGTCCGGGATGAGGCCTACAGCATACGACTTGACGCGGAAGTCCACCGTGAGCGGCAAGAAGTCCCTTTGCACCACTCCGCCATTGGCCGA
GGGGTTGCCATTGCGGTCACCACTCACGACCGTTGTGAGCAGCACCGTGCGGCCGCACGAGGCCAGCACGGCGCCGTCCGCGAGTTTGGCGAGCTTGCCC
ACAGTGTACAAGGTGTTGTCTAAGCTGCCGACCACCGGCTCCTTCACCTTCTTGGGCTCCGGCGGCTGAGTCTGAGTCTGCTTGGGCTCCAGCTGCTGCT
GCTTGTGCTGGTTCTGCAGCTTGGCGACCTCCTCTTCCTCTGGCGACGGCTTCTTGGCGCCGAACAGCAACTCGCGCAAACCGAAGAACGCGCGCGCCTG
TGGCGCTGCACCAGCGATACGAGGCACGCGTTGGCGAGCTGCAGGGATGGCGGCGCGGCGGGCCACGGCCGCGGCCGGCAGACGACGAGCAGCAGTGGAC
AGCATCTTGGTCAATGTGTGGCTCATGCAGCAATCATTGATTATGCTGTGGTGCACACTAAACCATGTTCTGACACACCACGCGAAACCAGCCAACCGTC
TTTGTTCAGCTATTCGACCAGCACAAAAACTTTCAACATCAAAAACAAAACGCTAGGTTTTTTTAAATCGCAAGGAATTGCACCATCCGTACTGGTCGAA
TAGCTGGTTCCTAGAGAACGAAGTGGACCCACACAATCAAAAAGCTCAGTCCGTCCGCACCAGCAGACCGTACTTGCTCCCCCGCCCTCCCCCCCGTCCT
CCAAGCCTCCAGACTCTTCAGCATGGGCACTCGTGTGTACGTGGGCGGCCTCCCGCGCGACGCCACTTCGCGAGAGATCCAGGACGGCTTCAACCGCTAC
GGCCATGTGTCCAACATTTGGGTGGCGCGTAACCCGCCCGGCTTCGCTTTCGTGGTGAGTTGAGCCCCTTCCCCTGCTGCGCGAGGCCTCGCATGATGGC
CCTGTCCTCCCTCTTTCTTCTACCCCCCTCTACCTCTCGGCGGCGACAGTTTTCCAGATCGGCAAGCGGCGGTCGGTGGCAACTTGTGTATGTTTTGTAT
GTGGTGTCTAGTACTATACATGTTGGTGTATACGCTACCGCCGCTGCTTCCATCCGGCCCTCGGTGTAAGATGATTGTTGTCCGTCTGCTGCCCGCCGTC
TTCGGTGCTTCCTTCCACTGCCGGAGGGAGAGATAGAGGAGACGTCGCTCTGCCGACGATGGTGGAGCCATCATGCTGCGCCTCGCCTCGCCTCGCGTCT
ATCGCCATCTTCATCTTCGCCTGCAACGAACCAATACCAACCAACGCCTCTCCATCGTCGTCCTCCCCCATGCTGCTGCTCCCCACCTCTACTCTAGGAC
TTCGAGGACCCGCGTGACGCTGACGACGCCATTCGCTCCATGGACGGCCGTGACTTCCTCGGCGGACGGTACGCGCTGCTGGGTTAAAGCGACTGTAGTC
TACAATACATCTAACTCTTGTGCTGTGAGCAGCATTCGTGTCGAGCTTGCTCGTGGTGGCAGCCGCCGTGATGGTGGAGGTCGCGATGGTGGCGGTCGTG
ATGGCGGTGGCCGTCGCGGTGGCGACGACGACCGTGGAGGAAACTTTGGTGGCGGTCGCGACCGTTTTGAGCGTGGTTAGTATACGCTCCAGCCAGTGTC
GTTCTCGTTGGTGGACTGATCAAACGTGTTGCTGTGTGAACAGGCCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTG
ATGTGGACTGGCGCAACGTTAAGGACTTCCTGCGCACGGGTGGCGAGGTTACCTACTGTAACATCGAGGCCGATGGCTCTGCGTATGTATAACAAACCTT
GGTGGGCTGATATGCTTCTGATCCAGTTACTAATTCTTGTGTTATTTCTTTCGATGCAGTATTGCTGAATTCCAGTCCAAGCAAGACTTGGACGACGCCA
TTAAGAAGCTGGACGACACGGAGTTCCGTGGCAGCTATGTGCGCGTCGCTGCTGAAGGTGGAGACTCTGCCCGCCGCTCACGCTCTCGTTCACCTGCTCG
TGGCCGCTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGTTGCCCGTAAGGACTCCCCTCGTCGCTCGCGCTCCAGATCAGCGTCGCCTGCCGCTGCC
CACTCGCCCTCTCCTCGTAAGGAATCGGCTTAAGCTGATGTGGATCGAAGAAGGCTGCAGATCTGCATTGGTGCGTACGCTACGCGGTGAGAGCCGTGAA
GGTCTTTGCTCGCTCACGTGTACAGTGGCTGGCAGCTCGACCAGCTTTGTTTGTTGCCTAGCGTCCCAAGGAAAACAAGCACATTAAACGATGGCAATAG
CTTCCTCTTATCATTTTACCCTAGTGTTAACTCTGTTCTCTAGCGTGCAAATCAATTCGCTGAGTGTCAAAGCCACATACAAAACCAACCTCACCAACCA
AGACTCATTCAATTTTCATGACTGCCTGTAGAGTCCTCAGTGTTAACTCCAAACATCGTCAATGTTGGGAGTTACTGAACTCTCTCCGGTATCTTGATTT
CTGGGATGTCCTGTGAGCTGCACACTGTTCCCTCCCAGCACATGAAACCTGTCAACATCATGGCAATCAAAGCCGAGAAAGCGACTCCGAACGACAACAA
GAAGAGGGAGACCTGCTGATGAAGGTGATGGTATTTGTGACTCCTGTTGCTTTCCTCTGCTTCCACCCCGTGAGCGGACTGCAGCGGGAAGCTGTTACGA
GAGACACCCCTGCCGTGCTCTGCAGGCCAGTCCTCTGCTGATCTCCTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGA
GCTTTATTATGCGCCGCACTTGCACGTTGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTAGTTATGAGAGATTCATCGTAAGTCAAAGATTCCTG
ATGCCGTGGAAGGGAGCTTTCGATTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTACAGATACT
TGGAGCAACGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGGGCATCTTTTCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTC
GGTGATCTGCTTCGGCTGTGGACAACGCAAAGCACACATCGGACTGTCATTAGCGGGCTGCGGGTCCATCTCCCTAGCTATCGCCGCATATCGAGACGCC
TCCGTACCATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAGCACTAGCACAGTCAACACCAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCAC
GCGCCTTTGGTTGGCCAGCAGTCTCCTTCCGTAAAAACTATTTACGCTATCGACGCGTAATTACCTTCGTAACCCCTGATGAGGTACGTCGTAACTTGTA
TGTGGCGCACACCACTCGCCGGCACGTTTTTAAACAGAGCGCTACACTTCATCTCACTATGGACGTTTATTTCCTCAGTTGGAAACGTCCATCGGAGCAG
CTCCAGAGTCGAAGATGGCGTCCAACCAGGAATGCCACATCTGCCTGGAGGAGCTGCGTCAAGACCTGGTGGCCGCGCCGTGTGGCCACGTCTTCCACCA
CATATGCATCTTGCAGGCGCTGCAGGTGAACACCCAGTGCCCCATCTGCCGCCGCCGTGCGGGCGACGCGGACCTCATCACGCTCTACTTCGATGTACCG
GGCGATAATGAGGCACCCGTCAGTGAACTGCAGCCGCTAAAGGCCTCGGGGGACAATGTGGAGCTCAGTTCGCGCGTCAACGCACTGATGGAGCGCATCC
AGTGGCAGAACAAGCAGCGCGAAGGCATTTTAGGCGAACTGCAGAGGGTACGCAGCCAGAGTAACCAGTTACTAGCCGACAAGCAGGCTCTCGCACAGCG
CGTCGGAGCGCTGGAAGGAGCCAAAGTGGAGCTACTGACGAAAGTGGCGAGGTTCCAGATGGAGCTGAGTCGCCAAACGGAAGCTGCAAGGCGCTCCAGT
GTGAACCAGAGCATTGTTAGGTACCTGGAGACGTGCGACGCAACGGCTATGGAGGAGGAAATCCAGAACCCCAGGGAGCTAATTATGGCGCTGAAGAAGG
CGTGCAAGTTCCGTCATGACCAGTATCAGAAGGTGGTGAAAGAGAAGATGAGGCTCAAAGAGATGCTGAAGAACTCCCAGCCACAACCGACAGAGCATAC
AGGGAATAGTGCAAGGTCGGGTAAAGCCAAGGTTCGAACAGCGTTCGAGACCAAGCGTGCATATCCAGCAGCAGGTAACGACGGAATGGCGTTCGGAATT
GGCGGCCAGCCGCAGTTGGTGGAGAACAAGAAAAGGAAAATCGACTCGGCGTCAGTGGCATCGAATCCAATGCCACTCATTGACAATGACGATGATGTGG
GTTTCACACCGCGCTCTGAGTCGGCGGGCTTCCGCGCAAACGCCTACTCGGACGTATCGATCCGTCCGCCTCCGAGTTCACGGCAAACGTTTGGGCGCAG
TAGCTTCAATCCGAACCAGTACGGAGCTTTCAACCTGTCGCCAGCAAGCCAGCCACCCGTGCAGATGGCAGGACTCCAGGCTGCGGTGTGTCGTCGTGGC
TATGATGAAACTGGAAAGCTCACCAACTTTTTCCTTCCATTGGGAAAGGAGAGTGATTCACGGTCCATGCCTCGGACGAAACCCATTCCGAGCATGCAAA
ACCTGCTGAACGCACAAACAAGAACTTCGGGTCAGCAGCAGCGCATGGCGAGCAACGACCGACAGGAATACGCACTAACAAACTGGCTGCGCAATAACTG
AAGGAGCCGAGGGGAAAGCCCGAGGTCGCAAGAAGGCTCTGAAATTTGCGGTCAGAAAGCTGTGTACAATACGATACTATTTGCAATGTTAGCGGCCGAC
GATTGTCGTTCGCCCTTTAAACTTTAAGATATGTTGCTTTTGCTTTAGCGCTTTTCTTGAGAGCTATGGAGTTGGAAACGGAGGTTTGTCAGTGTTGCTT
GCAACGTGGCTTGATGTTCCTTGATAATGTTGATGACCTCAGCGTCTTGGCTTGGGAATTTCTTACCGGAAATTAGACGACGGCAAATTTCCTCGATAGA
TAAAAACGAAGTGTCTGGGTTGCTGCATTCCACTTCTACTGATTCAGGTTCAGCTAGTGCTGGGTCAGCGTCGGCCATAGCGGTAGAAGGTTGCCCAATA
CTTTCATCTGGCTCACCGACTTTGTCGCTTGCATTTTGCCGTGAAATTGCCACAGTTTTCGATCGCCTCCTTCCAAGAAATGAGAATTCTACTGGCTCCG
GAGGTTGTGGCAAAGGCGAAAGCTGCTTGCAGACACAGTAAAGAAGCGTCGCTAAGTTGGCCAAATTCGCTGATGCCTGCTTGCCAATACTCTTGGGGCC
AATACCTACATTCCAAGGTTGCAAGATGACATGCGGGATCAGGATCCGCACAAGCAGAAAATTGATCACCACTACGTTGAAGCGCAACTGACTACCACTT
TCAACGGAAACCATTTCCCCACTGCGACCATGCTCATCTGAATCAAGAAGGCTGGTTCCATCAAAATCCATTCTCCTGGTAGCACCGAGGGGGTCAAATT
CGAGACTGCGCCGCTCTTCGTCAAATAGTTGGTACTGGATCGAAGTACATCAGGATCATGGTCAGGTCTGCCAACAACTACAGTGGAAGTTACTCAACGT
ACGCTGGGCGGGAAGTAAACGCCATCCGTAGAAATCCGCTTCCAGAAGTCCATGATGCCAAAAGGGACCTCCTTCTTATCGATCGCTTTGCCCAGTGATT
GCAATACTCCTCTCATGTGCACTTTCAGCTTTAACAACTTCGCTGGATCCACAGCACTATCAATTGGATGCCCGTTACCCGCGAGAGGTAGCGCTGGTAC
AGGGGGGCGACGAGCAAGGATGCCACCAAATTTCTTAGCAAAACCTCGCAAACTTGACCCCGCAAGACCATTTTTCGTGCTGATGTCCACGTCTACACTT
GGATCCTGAATCAGTGAAAGCAATGGAGTTCTTACCACCTTTCCAAGCCACATGCGAGTGGCGTCAAAGTACACACGTAGCATCGCCTCAAAGTCCTGAG
CAGATTTCGTCAGAGGAAGAGTGAGATGTTAAAACCTTAAACGGTATGTGTTGTGAGCATACCCGGATTGCGCTCTCCTTTTCAGCCATTTTCTTGTTCA
TCAACAATTTTTTTAGACACAATGTGTACATGACAGCACGTACAGCGGATCGGAAGATTTGAAGAGGTTCCATCGCTTCAGCATCTTGGAACCCGAAGGG
TGACACCTCATCGCTTTCAGCTTCAGACTCTAGACGCCAGCGTGGTTTTCGTAGAGCGCCGCTGCTTGCGTTTTTAAGAGAAGCATTTAGCAGTGCCTCC
AATCTCTTACGGCTCTCAAGGCGCTCTCGTGCTTTTTGCTCGTTTGAGGTGCTGGTGTTCGCACTCACTGTGTTTGCAGTTGCATCACTTTCCTTTGCAT
TGTTACTGCTACCAACCACATCACTTCCTGTAGCGATATCCTCATCGTTTTCAAGTTTACCCAGGGTCTAAGCAAAAAGTGGTTAGTATGGTGAGCAAGA
GGCAATTGGATCAGAGGCGCACCATTTCATCTTCATCCGTCCATTCAAACTCGGGAAGCCATGACAGAGGAGATGGAGTTTGCAACGTTGAAGAAACTTT
CCTACTTAGAGATGCGCTGTGTGATTCTGGCTGTATTGTTGGGGTAGATGGCTCCTGCGCGTCAGTAAACTGCATCCATTTAGTCTGTGCGTTAGCGTTT
TCCTTTGTGGGGGAATTAGGAGACAGTGGCGGTTTGAATGGTCTCTCCGTGCTCAAAACATTATCAGCATCACTTCCACGCATTAAACCCAACAAATCAG
CAAGTCATGATAAGCATTACGCACAGTAGAAGAAATGAACATATACACGTACTGCCTTCGCGGAAGTAACAGTGCCATGATCTGTTCGTTTTGGTGCACC
AGTCTCTCAATAAGGCGCTCACTTGACTCGGGGAAGCGCTGATCAAATCGTGTTATAGGTGATGTTTCGAGTGCCCCTCCAAAACCGAGACGAGGAGAAC
CTCTTTGTACTGGATTACGTGTAGATGCCTTGAGCTTGAAATCAGCAGTTTATTGAGCACAACAGACCTTCAACACATGCAAGACTGTGTCAAGCTGTCC
TCACCTCATACTGGTCAACCTGCATCTCAAGCCGCTTCACTTGAGCTCTGTCGAACATGTCAACACGACAATATCTTGCCTCAGATAAAATTCTGTGCCA
GATACGATAAGCAAAGCCAGAATCAGTACCTCAACTCTTCCCGGCGTTCTTTGCGAGCCGCGATGAGTTGTTGCTGACGCATTCGCAGCAATTCATCCTT
TACCCCCTCTTGACGAAGAGAAAGTGCCATGCATTGTGGCGCAACTTGATGTAGCGAGTACATGTCACTCCTTGGTCCGGCGTGGGGCATGCCCACGAAA
TCGGGAGTTGTCTGTCTTTTTTTGGATGCATCATAAATGGCTCATAGACAGACAACTCAACTCGTGAACGATCAGACGTGAGACGAACAGCGAAATCTGT
GTATTTCTCCGCTGGAATGTTTCTTGATCAACTCTCCGCTGTCACTTGGTCCTGCTTATCAAGAGTATCAGTAGTGACAGGTTTGTCAGCTTCAGTGGCA
TTCTTCTGCTCCTCCTTCTGTTTGCCATTGGCTTCTTGTTTTGCGATCTCCTTGCGTGCCGCTTCTTCTCGCCCGAGAAAATCGTTAGTCAAAGACTGCT
GCAAGTCCTCGATTTCGTGGAAGACCTCCAGTGATTTCTCCAGGATCAGCGTAGCAGACTCCAGCGTGTTCTTTGATGCCTCTAAAGTCATGTTGGTAAA
CAACGTGTTTGCTTTGAAAGAACCTTTCGCCATCGTTGCCTGGACACCACGGATCTGGAACATGAATGCGGCAGACAAATGGGGTGCATGTAAATACAAA
TAGTGTAGCAGGGCAAAGAGCAAGCAGCATATCGACATCTAATGCTGTTACCTGATCTGACAAATCCCGCACTCGCTTTGAGATATCCCCGTAGCGGCAT
TTCATCTTGCCACAAATCACAGGCAGCGAAGCCTCCGCATCACTGATGTCCACCACGCCGGGAGTATGAATTCCTTGCGCTGCAACACGATCTTCCTCCG
GAACAAAGGTAAGCAGCGACGCCTTGAACGTGCACATGCCCGTTTTCTTCAGTCCATACAACTTCGTGTCCGATTCCGGATTGCTGGAAGGAATAAGCTC
CACAGTCATGGAGTAGTGATCGTTGTCCATACACTCGTCTCCGTCGTCATAGATCATGTATTTGTAATTCATCGTGATTGGATCAATGTGCCAGCCGCGG
AAAATCCTACAAACACATGGAGCATTCAATCAGCGCTTCTCCTTCCATTTGCCAATGACCTTCAAGTCTACCTTACCCGAGAATAGTGGGAATTTCCGGT
TTCTCTTTCTCCTCTGACACTGGTTCTTCCAGCTTCGCAGATGAATCTCCGTCCTCAGTCGTGTCCGGCACGTCCGCAACCACTTCCACCTCCACCTCGA
CTTTCTCCTCAATCTTGGCCTGGATTGTCACATTTGCTAGGTGGCAGAAATCTAGAGTATAGCTGCAATAGCGTTAGATGGGTTGGAGTCTCTTGTAAAA
TAGCGTTGCGAAGAGCGTTCTGCCTACGCTTTGCCCTGCTGCATCTCCCTCTCCTCGCGAACGCACGGCAGCGACTCGAGTTCATCAACAAATGGTCCTG
CCTCACGTAACATAAGAGGAAGGACGCACTACACGTTAGATATTTTACATTATTTCACACTTCGTCGCATCGCAGACTCGCCTTGGAATGCGGGAAGTGG
ATCGCGGGACGGCACCGGCAGCAGCACTTGCGGCACCTCCTCTTCTGGGCGCGGGCGCGGGACAATCCGGATGTCGACCTTGGGCGCTCCTGTGCACAGC
GTGCTGCTTAACGCCACGACGGCCATCGCACCGGCGAACACGCTCCTGCCCCGCATACTCGTCGCTAGCTTGGCAATAATTGCAATAAATGTGTTTTCGC
AGGGTTACTTCGTATGTTACATTTCGTCGGGTATGTTATGATACAGGTTGTATAACTATTGACAGGGATTTCGCGAGTTGAAGATGTGGAGTGATGGTCA
TCAAGTTTCGTGCGGAATGCGCCGCTCAGTGCGGAATTTGCCGTGTCGTGAGCAAGCGACCGAGTGAAGATGCAGGAAGACGGCGCCGCGGCGATTATGA
GCGGCGTGCACCGGGCGATAGAGCTCCTCGCCCGCGCTGCAGAAGCCTTGACGGCTTCATATGACAGTCACCAAGTTTCCTCGACGGATATTGATGCCTT
GAAGCAAGTACTCGAAGAGCTTCAACGCCTCATCCTCGAAGTTGGATCGCAGCGTGTACTGGAGCTGTCGGGGGCGCAGTTGATGAACGCTGGCGTAGAG
TTGTACAACGCGCCTCGAGCTGCTCTTCGAGCTCTTGAGCAAGTAGAGAAATCCAAGACGAAAACCGACTCAGAAGCTACGAGCTTACCACGGTATTTGT
TAGCGGTCACGCGATTTGTAGCTGCGAAGGTCATGGAACTCTCATTGGTTTGCTCCAAGAACGGCGGTGGTCAGGAAAATGGAGCGAGGAGAAACACGCA
GTTCATGGATGAGTGTGTCGACGTGCTGCGCTCGTTTGGACGAGTGGGAATGTTCTTGTTGGAGAGCGCATCAGTTGACTGTGAAAACTGCGAAGCGTAT
TTGGAGCTGGCAAATGAGGCCTTTTCTTCTTCGATGAAGCTCTGGTCTCGTATTGGCCTCGCTCATTTGACAAAATTTAAGCAAGGCGTGGAGCTGGACG
ATGTTGTGGATGATTTGTGGGACTTTTGTACCCATCACGTACGCGTGCTCCAGCTGATTTCACAGCGGCCTGACAATTCAGCAGGAGAGGCTCGAGATAT
TGTGTCATTGCTGAATGAGTTGAAGATGCTCGCTCCGTACAAACCTTCGTATGCCAGCAGCTTGCTTGATCTCATGCGCAGTGTTAGTGATGAATACAGT
CAAACAGCGCAACACGAACTGCAGGTGGTTTTTGCCGAGGAAGCGCTGCGTGTGAGTGAATCGCTTGAAAATGATGCAGACGAAAACTTTTCGGAGCTGG
TTACGTCGTTCAAACAGCATGTGTTGCTGAATTTGATGCAATCTCTCTGCGCTAATAATGACATCGAGCGAGCAGAAGCGTGTTACCAACTCATTCCAGT
TAATCGGAACTCCAAGGTCCTTCTACCCATGATTAAGCTCTACGTCGACAACGAACATTTTGATAAAGCACATCGCCTACTGCTGTCGTTGTTTCAACAA
GACAACTTTGACGATTCCATCTTGGGAGCACGCACATACGCCCAGGGGCTGTCTTTCTCGATCAAAGGAATGGATATTTATCGACACCTAGCCATAAACT
ACGGGGATTGCGCGCATGCCATCAATGTGGAGATCGCATGCAATCTTGCTGTGGAAGAGAGCAACCGATACCGAGCGATGTCAGAACTCAAACGCATTGG
CCTCGAATTGCTCGAGATGGAACGGTAAGAAACCATTGGGTAATCAGACCGGAATATAACGTCTCACTTTTAATTGCATATTACAGCCTAGGTGAAAGTG
GTGATAACAGACTTGTCCAGCGGGTTCAACAAACCATTTTTGATGCTCTTCAACTCGCACTTAATTCCAACCAACACGAGGTAACGAATCAATAATGGTG
TGCAGCGCGGCCAAATCGACTCAGTTTCCAGCTTGTAGGACTGTTTGAAGTGGGCGGATGCGGGATTGGCTTCGGCGTCATCAGCTGATGATAAAGCGAC
GTACATGAGGTAACATTGATTTAGAATGCGTGACCACTACATCAAACATTGATGAAAGTAATGCTCTGTAGGACGATGTCGCGTTCTTGCCTCCAGTTGG
AACGCTATACTGAAGCTGGGGAGTGGGCAGAGAAGGCGTTTGCTGAAGAGCCTTCTAAGCAATCTCTATTCACTGTTTTCCAAGTGGCTCTACAAACAAA
ATCGAGTGCCTCAAATGAAGAGCTGGTTCACATTATGGAGCAACTAAAAGGCAGGGATGATTTTGAGATCGAAGATTTCCTCGCCATGGGAAAGCTGGCT
GATGATCTTAGCCCAGCAAGACAAGATATCGTGATGCACGTTCTCGACGAGATTTGTCGCACGATGATGCAAACTGAGGACTGCCCAGCTAATCTGCCCA
AGGAAGTCATCCTACAAAATGCAGCGCAGCTAGCATTCAGCACGTTCGCTCAGCGGCAGACTGAGCCAAGCCCTGCTTCAAGTATAATTTCCTATGGTGA
GAAGTTCCTGGTTTATGCCTCTGCATTGCTGCAGTCATCAAGACCGGGTAGCATCGGCAATTTAGGGCCTTCTTCAGTGTTTGAGTGGTTCTATCGAATG
AGGTATGACTCAGGATTTCTTTTTACGAGTTGGAATTGCAAACTCACAGTGGTTTCTTGATGACAGCTTTGACATCGCCAAAACCACCGGAGACGCCAAG
TTCTTTATCGTGGCAGCAACATTGCACAACGCAGCGACGAGCTGTACGGAGAACAATCCCCACTCAAGCAGCGATGCCAGCTAAGTTTGCTGGCAACGGT
GAGCTCTGACATGAAAAATATAGAGACACTGGGCAAGAGTCAACTCTTGCGGCTTCTTGAAGTGATCGGTCGATTTGAAAGTATCGCTTGTGGGGACATG
TACGCCAGTGCTGATGTGAAGATCTACTTGGTACGAAGTATGTTTTTATGCTTGTAGCAAGAGAAATGCTGTTCACCCTGATGATTTCTTGTCGACAGGC
AAAGTCAGTGATAGCGGTGAAATTGCGGCTCTTTGACGCAAACACGAAAGCAATTCTTGATCTCTGTAAGGCCACAGTGCACAGCGCCACTGACCTCATG
CAGATTGGAGGTGTGGCAGACGCAGATGATTGCTACCTCTCGCAATTTCGCTTGCACTAACACTGTGTTGAAGATCTAGTGCTGTATGCTACAAAGTTCA
ACGAAGCATCTGAAGTACGGTTTTTTCGGGCTCAACCTGTAGACAATTACACTCACACGGCTTACTTGAGCAGATTCGAAGCAGCTATCGATCACTTGCC
AGCGAAATATCCAGCTTCGGGTACCGGCTATAATGTGTTCATTCAGCCATGCTATTGAACACAAATTGCTCACCCGAATAACGTATATCGATCAAAATGC
AGGCTCCAAATGCTGGTCCAAGAGGATTCCATTGACGCGAACAAGCTGTGCTATCTGCTCCGACGGCTCATAACGCTAGCTGAATCGAAGACAAAAGCAT
ACGAGTGCTTCGACCAACTGATTCAGTTCATAGACACTTTGGACGTCCCGCTCACTGAAGTCGACATGGAGTGGTTTGTTGTCAAAGCGTGGAACATCGT
AAGTGAGCTTGTTGATCTCGTCCAAAAGAAGTTGTACTTCGAAGTACTAACCTACGCAATATTTGTAGGGTGTGTCCTGCCATCGCAGCAATGACGCAGA
AGGAGCCCTCCGGTTTACAAGGACTGCTCAGACCATAATGCGTAGGCAGATACACATGAATTTTGGCCATCCAAATTGCAGGCTAACTCGTGTTCGTTGA
TTATGTGCAGAGCACAGCGAGTCCCTCGTTGGAAGGTTGGGCAACAACCTAGACGCACAATACCAAACAATGCTACGAATGAGTTCCCTACCAAAGATTG
GCGGGTAGTCAGCGCGTAGCGCCCTAGCGCCCAACAGGATAGCGACTTTATCGACCGAGGCAAACAGCGTACAATTTACTTCCCCATTGCTTATGCCTCG
TACACGTCAGGCGGAGAGCCATGACTCGATACTCCACCCATGTGCGTCTTTATAGCCTCCATGTAGGTTCGCAGTGTAGGTAGGTCTGTCGTTTCTTCTT
TCTTTAAGACCTTCGAGGCCCACTTGCGCTCTGCATACTCACAAATCTGGAAAAACAAACGTAAGCGACAAGTTCGCAAGGTCAGCGTTCACAGTGAGTT
CTACAAAACTGGAAAATGATAAAGAGTTAAACCCACCTCTTTGATATCTCGGCACGAATGCTGCGGTGAGACAGTGGCCAGCTGCGAGAGCTCCTCGCCG
GAGAGTTGCTTAGCATAACTGCATAGAATAGGGAACACCAATACACTGCTTATAAGTTGTCTGCCAAACCACAACTTCTTCAGTGCAGAAGCTTACCGAG
AAAACACCGCGCGGCGGGTCTTCTCGTCAGGAAGGTTGTAGCGAATGCAGAGATCAAAGCGACTGATCAATGCGGCATCCAAATCCTGCTTTCTGCAGCA
TAAAACAGCAATTACGTTTACAGTTTAGCAACCTCCCGATGCACAGAAGGCATCATCTGAAATTTAACAATGCATATACCGGTTCGTAGCGCACACAACC
GTAGTCTTCTTAGCAGATGCAAAACCTTCCACTTTTTGCAGTAGAACCGACAAAATTCGACGCGAAGCCTCGTGCATTGTGCCACCAGAACGGTCTCCGG
CAAGGGCGTCAATCTATTGCAGACAGCAATTCATAAAGTATCAGTAATGTTAACGCTGTACTTCAAAGTACACCAATAGACAACCAATGGGGACACGCAC
CTCGTCAATGAAAATAATGGCGCCATCGAGTTTCTCGCACGCGTCAAAGATCGCAGACATCTTTTTTTCGCTGTCGCCGTACCACTTGGACACCACACTC
TCAATTGGGATATGTATCATTGGAATTCCAGCCTGCTGTGCGATGATACGAGCACTCAATGTTTTGCCAGTGCCCGGAGGGCCTTCAAATAAAACAGCGC
GTGGACGATTGCTTTCGTAGCGGCAACGGGTTTTCTGCGCAATGCGCTCGTAAAGTTCTGGGTTCTGAAGCGCCAGCACAACCGTGTCTTCGATCTCGAG
CTTCACGTCTTCGTATCCAGCCTAACCATACAGAAACATAACCAAGAGTCATAATTGGTAAAGCGCTACTGCTGTTTACCCCTTTTCAACAAATGCATAC
CAGACTCTCCCAGGTTAAACCGATTTCGCTTTCTGTTGGCTCGAAGACATCAATACCTAGCCCTTGAAGCTGCTGGATTGCTTCCTCCTGCAACCAAAGC
GCACCATGTGAGTTACTCAAAGTAGGACTACTAGCAAAAACAACAAGCCAACAACGGACCTTGCTGCCAGGGGTTGCTGTTGTAGCTGTGGTCGGATTTC
TTCCACGTCCAACAAGTGCGTTCCTACGCCGCTGCTCAAGGTCATGACGGAAGAAGGCGTTCACGTTCGTGTACGAGTAAATCTCCTTGTAGGCACCAAC
AATAGCGTCGATCTCGCCTTGCGTTAGAAATTCATCCTTGTAGAAAACAAACTTGGATGTCGCTTGCAATGAAGACGAATCACGCAAGAACTGGAACGAA
CCAGAGCCGTTCGTGTACAAGTACGTCACAGCAGGCTGTTCGTAGGCCTCCACCACCGACTTCTTCGCGGTGTTATCTAGCGGCATCACCTCTACCGACT
GCTTGGAGGCAGGCGTCGACGCCTTTTGCAATTGCAGTAAGAAGCGACCAAGGATAGCTTCTTGGTCCACGAACGTCGGACACGCAAACTCGATCCGGAT
CGTCGACACGCCGTTGGGCGCGTGATCTTTGAGATGCCAATCTTCTTGATCGGAAAAGCCTTCGGGATGCGCGTCTCGGAGCTTTTCAGCGTCGTACGGA
ACTCCGACACTTGCTGGCGAATGGTATCCACAGCTTCCGCGTACTCAAAGTGCTGCAAACACAGTCACAAATGGAGCATTTAGTCTTCCTCTCACGATAT
ATCTAATACTTCAATAAAAGGTTCCTCCAACCTTCTCCTGCTTCTTGTCAGGGGCTGCCTCCAATTGTGTCGTGTCCGCATTCACCCCCACAACACCAGC
GAGAGCTGCAGCAACAGCGAGCACAGCGAATCTATTGGGGCCTGAGTCGCCAAAGGCCGCCACGACGCTCAGAGGCCGCAGCGCTTGGCTGGAAGGAGCT
GCAATGCGACATAGAGAGGCATCCATGGCCACTGGCAGCCGCGTGGACTGGACCACGGCGCGTGCTACGAGCTTGACGGCGAGCCCTCGCTGCATCCTTT
TGTCTCGGATTCTCAAATAGAAGTAAATAGTAATACCTAGGTTTCAGTAAATGCACAAAATTGGGACAAAATGCTATGTTCGAATTGAGTTTAACAGTGA
CTCTGATTAGGAAATCGTGCTGTCATTTTTCTTGCGACTTTATCAATTGATACAGGTCGAAGTGACGATCACATATGTAAGGGATTTTACGGGTTTACTC
ACAGGAGGTGCATGTTGTGCGAGGAAAAGCGATATTTGTATTGAATGAGTGAAGGGAAGCAGCGTCACTATTCGTGACTCACTAATGCTTGACCATCTAG
CGACCACCGCGCACAAACACTTTTTTTGGTGGGGTCTCGGCAGCTTTCTGCTCTTCGCCTTCACACCGCTGTCGGAAGGTGGCAAGCTGTCGTCTAAGGG
TGCTGATCGTCTGGGCTTTCTGGGCAAGAATCTGGCGCACGTAAAGCGTCGTCGTTAGCTCTGTAGACGCCATGGCACAGCGCTCAGGTACCTACCTCTT
CCAGACGCGAAACATACTGCTCAATACTCGCCGAGTCGCCAGTGGCGTCGTTTTGAATAGCTGCTAACATGGCACCTTCCTCTGTGAGTAGCTCTGCATT
TTCCTGGACATATCCATCAATAGCGCATTAGGCACGAAATAGCGCAGTTCTGTTGCAGACAAATAAGAGTAACAAACCTGAATTGCATTCATGTGTGTGC
TGAGCAAACCCTCCTGCTCTTCATACAGAGTCTGAACCTGTAGTCATGCACACACTATTGTCAGCGTTGCTGTCCCTTTCAGCACATACAAGTTAGGCAA
CAAGCTTAGCATTACCACTCCCTGCCACGCTTCCTCTGAATATCCGCTTTCCAAGGCAGAACCACTTCTTTTGTCTGCTTGTACAAACAGATTAGAGCCA
TGTAGAGGATAATCGCAAAGATAGCAGCGTACCCGAATGGTGCCGACGACTAATGCGGAGAATGCTCAAGTCGTCGCTCAAGTCGCGCGTGTGATGCGAG
GAAATTGTCACTACATCCCTATTCCCACCATCAGCATCGCTCCTGTACTGATCACCACCGCCTTCGAGCATGTCATTATCATCGTCTTCTTCTTGACATT
CCTCTTCCTCCTCTTCTTCTTGCTGATACCCGTCTTCGTCATCAAACTCCTCAGCATCGTCACTCCCATCTTGGTTGGGATACGCGTCGTCACCGTCAAG
ATCTGTTTACGGCACGACGTAACCTCAACATTAATGTTCACCCCATGGTAGCGATTCCACGAGTTCACACGCACCCTCTTCAAATTGGACGTCTTCGACA
CCCACAGCATCAGACTCAGTATTCCTCTCATCAAAGGCATCCGCAGAAACACGCTTCTCTTTGACCCGATCAGCATAGCGAAGAGTATTGATCGTATGGT
CCGAGGACGAGGCACACGGCGAGACAGCGGCAATCATCACCGTCCTATCAAACAGAATTCAATCAGTTGCAAAAGCTGGTTGGTGCTGGATATCTTCAAC
ACGACTTACTTCGCTTTGGCATTGACAAACGAATCTTTTAATACTTGGGTGAGCTTGCTTGCTCGAAAAGGGATATGAGTGCCTCGACCACCACTATCCA
GCGCTCTATTCATCACAAAAATGCAACGCAAATGAAAGGATTAGGAGACAAATCTTAACCGGCCGCCATTTATAACGTACCGAAAGCACTCCTTCAAGGC
CAGCAAGCTTCGATTGATTTCCGCAGACTCCAATCGTCGCTGCCGATTGTGATTCTTTGTATCTTCACCACGCTCACTACCCGCAAGATCGATCAATGAC
AATTTGCCGTGGAGTTGCCCAGTTGCTTTCTCACGAAGATTGATCTGGCAGATGCAGTGTGATCGTGATGAAACATCATTCATCTCCGTGGCATGCGTCG
TGCGAAGACTGTTGCCTTTGCTGATCACTTGCAGCAGCTCCTCAGTATTCTGCGGTTGCACCTCCTCCAAGTCCACAATCTGCACTTCGCCTGCGCCATC
TTCACGAATCGTCAGCACCTGTCGATGCAACAAATCCTGGCATCGACCACCATAAATCTCAAAGAAGCTCACGCAAATATCCAAAGGATATCCGCGTCTT
GCGAAGTCGTCGGCCTGCGCAAACACATCTGCCGCAATCTGGCTCTGGATGCCTTGCATCGTGTGCGTCTTGCCACTACCCGTTTGTCCGTATGCAAACA
CCGTAGCATGGCCTCCGTCATGGAACACAAACTTCACGAGCGGTTGAGCTGTGCACATGTACACACTCTCATTCGTCGCATTCTCATCAAAAGTCTAAAA
ACAATAAACAATTATCAAACACCAGTCCACAACCTCCATACCTCACCAAAATGCCCCGTACATGGTCGAAATTGAAGGCGTTGCTGTCCAGATACTTGGT
GATACCGTCCACCTTGAGCTTGCAGTAGTGCACGATGGACATGGGGTTGAGACACGTGACGGCGTCGTAGTCGTGCTTCTTGACCTCTTTGGCGTTCACC
GGCCGCTTGCGCACGCAGATGGTGATCTTGGTGTCCCCCGCCTCAGCGTGTGGCCGGCTGCGGTCCTTGTTCTGCTCCCGGAAGGCCTTGATCATGCGCT
GGAAGTCCACGTCGCCCGGGTGGCCCATCTTCTCGTTTAGTTGGCTCTCCCGCTCGCGCTCACGCTTGGCCGCCGCCATAGCGCGTCGTCGGTCCTCGCG
GTTCTTCTCGATCTCGGCGATGGCCTGCATCGTCGGCTTGGTGCGCGGCGTCGTGGAGGGAGCCCCACGGCCGGCGCCACCGCGCGCATTACTCGCTCGC
CACGCCATCCGTCGTCGGTTAGAAAAATAATCCACCAGCGTAATTATCAGATCCACACTTCAATTTGGAATCAGAACGTCTCAGAAAAAGTGACTTTTCT
GATTCTAGTTGCATTTCAAAATTGACAACTATGGCAAGGCAGGCGACCTCGTCGACGCAGTTGGAGGCGGCGATCGACGCCGTCGCGAGCGGCGCCATGT
CGCTGCGCGAGGCCGCGCGCAAGTTCGACGTGCCCCGAACTACACTGCAGCGCCGTGTGCAGCGCCGCGCGGCGGAGGTACCCGAGTCGGAGGAGGCGTC
AGAGTCTGTGGCGGTCAAGGCGGAGCCTGTCACAGCTGATTGCAACGCCCAGAGCGACACGAGCGGCGAAGAAGCTGCAGAAATTTATACTGAGGAGCAT
GGAAATACTGCAGAGCGTGACCAGAGTAATATTACAGGACGCAAGCGACTCGCAGAGCAAATGGAGACACCGAACCAAGGTGGGCAATTGGGTAGTAAAG
CTATATTGGTTTTAGTGGGGTTTGACCGACTTTGCGCGTGGATTTAGGCCCGCGGAAGGTCATCAATTGCAAGATTCGGATGCTGTGTACGGCGGCCGGG
AGCGCGTTGGATGAGTTGAGCAACAAGATGATCCGGGAGGGCAAGTGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCCATCCCGCAGTGCATTG
TTGATGAGCTACGGTGGGTGGAGGTTGTAATTGAATTTGGGATTTGTTGAAGCTGAGCGTGAGTTTGATTGCAGCGCTAACTCGCATCAGCGGGATTATT
TGCCTGTTGCGGGGCTGCCGGAGTTATGTGACGACATTGCTGCGTGGGGGGCGGATCGATTGCATATTGACTACTCGCGGGATGACGTCTTGGTGGGGCC
TGGAACTAAAGAGCTGCTGTTCGTCCTACAAACGGTGTATTATGGAGACCTGCTGCTGCCCAACCCGAGTTGTACGAGTTACGCCCCGCAAGCAGCTATT
GCTGGGAGGTGGGTACTTGAATTGTATGGGGTTTGCGCGTACAGTTAGCGAGGCGCAGTCTAACCTAACTCTGCGTAAAGAAACATGATGTGGCTGCCAA
CTCATGCAGAAGATCACTTCGTGCTGCGTCCAGAAGTGCTTGAAGCGCACTGCTCGAAGGATCCAGGTACGTGCAGCTACAGTTAGCTTACATCATAGAG
CAATCCGAGTTTGCTGACACGGGATTATTATGTAAACCGTCAGACGCCCCGCGGATTCTCATTTTGAACAGCCCGTCAAACCCAACAGGGTGCGCTTACC
AGGCCGACGAGGTTCGTGGTTCTGCCAAGATTTCAGTAGAGCGACGATAATACCCACCTGACGTTGCTTCGTATGTTGTGTTCATTGATCATGGCTGACC
AGCTGGAGGCACTAGCAAAAGTCGCTAGGAAGTACCGGATTCTCGTTGTATCTGACGAAATCTACTCGGAGCTGCATCATTCCGGCACACATCTGTCGCT
CTCCAAGTACTACCCGGAAGGAACCATCGTTTCAGGAGGATTGAGCAAATGGTGCGGCGCTGGAGGTTGGCGCATGGGCTTCTGGTTGTTTCCGCCAAGT
ATGGGCTGGTTGCGCAGCAGCATGCTCGTTATGGCGTCCGAGACGTACACGTCAGTTGCATCGCCTATCCAACACGCTGCTCGACGGGCGTTCGTTCTTG
AGTAGGCAGCACGATCCAACATCCTCGCGAGAAAGCGACGCCAGACCCCGATTCTAACATGTTGCCTTGTTCTGCGCTGTAGTTGCGTCGAGCTGGCATC
GTACAAACGCAAGTGCCAGAAGACGCTGCAGCTCATCGGCCGCTGGTTCTCGTACCAGCTGCAGAAGATGGACGTCGAAGTGCAGGTCCCGGAGGCGGGC
TTTTATCTGTTCCCATGCTTCCGCCGACACCGCAAGGCGCTCGCGCTGAGAGGCATCTCGACTGACGAGCAGCTGTGCGCGCAGTTGCTGCAGGATACGG
GCGTGGCCATCTTGCCGGGCTCGGCCTTCGGGCGTGCGTCGGAGGAGCTCTTCGCACGACTGGCGTTCGTGGACTTCAAGGGCGACCTCGCGCTCTATCT
CATAGAGAGCATGGTAAGCAATTCCTTCAATGTGAGCCTTTGCCACCGAAAACTCGACTCATTCACCCCTAACGATATTTTGTGCAGCAAGATGACCCGT
CTTTGGAGGCCATCGAGGGCTTCATTCAGTCGGTCTGCCCCAATCTCGACATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCTTGCGCGGCCGTCTGC
CGCGCCAGCAACGGCCAGCGCCTCAGGCGTCGCCTTCTAACGAGCGAGCAGGTCGTGGGGAAACCGGTGTGCGCTCAATCGGTCGCCAACTGCTGCTCGC
CGAGGCTGGAATTTTGTCTGGAGGTTTGCACGTGAATGGCGCAATGGAGACTCTTGCCAACTCGCCGCTGACGTCACACGAAACCGCGCCCTGTGACGTG
CTGTTTCTTGTCAAACGAGAAGGCATCTTATTCGCAGCATTGCATTGAACCGCTGTCCACGGAAGCCCAGCTGCAGTCGACGGAAGCTCCGCTGAATTGA
AATGAGTTGGTGCCAGTGATGCCACTTTGAGCTTCTGCTCCGGGGCCAGGGCTGGCCACTTCTACATGGCACTGCGCAGCCGATTTGTGGCGAGAAAGTA
GCGCTGCCCGTCCGACCCAACATGGAAGGCCAACACCAACAAAGCCAAGTCCATTCGACCCACCCTGGACGGCCAACACCACCAACAAATCCAAGTCGGA
GCCATCCACAGGTCCGTGGTGGTTTCGTCCGATCGATTGATTACAGTAGTTCTCGTAAATTACACATACATAGCCTGCAACCCAAGCCTCGGTACAAAGC
CACGAAGAGACGACTGGGGGAAGTTGTCTCGGCATTTCACTTGCTGACTTCTCTCGCCTTCTCGATGCCTGCGGTCGACGAGTACCCGCGCCGTACGCCG
CCCCGGGACGCCGCGGCGCGCTCGCGCTCGGCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGTTCCAGCACCAGGTGCAAGTGAGCGGCAGCAGCAACC
TGCGCGCGTCGTACCAGGAGCCGCAGCCTTCCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAGCGCGCAGATGCGTCACTCGCTCACGCACGTGCAGGG
CTCAGACGCGCAGCGCTCCAGCGCGTCGTCCACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGTGGCTCCAACTACCTCAATCTGCACACTACAGGTCGA
GAGTTGAGCCCCCGCCAGCAGCTGCACCCGGAGTACCCGGCCGCGCCCCCCGCGGGCGATGACGTTCTCAAAGTAGAGATCCCGCGGTGGAAGTCGAAGC
TCACGACGGACAGGGCCGACAGACTGCACATCCCAGCAGGAGCCGACAGTGCAGGCAACTCGCCCGTGGCCAGCGGAGCAGGCAGATCTTCGACGTGGAA
CGGCAAGGACGGACGAGGCGGACACGGGGGCTCCATGGGGGCGCTGGTGCTCGGACGGGACCGAGATAACGGATCCAAGAAGCGCTATACGGTCTTCCAG
GTGTACGTGCACTTCCAGTCGGGAGCTGTCCGCGTGTCTGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACGCTGAGGCGGAAATACGCAACGG
TCGGGAAACTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTGTCGCTGCGTGTGATTGAGCAGCGCCGGGAAGCGATTGAGACGTACATGAACGCGGT
ACTGACCCTGCGACCACGGCCGATTGAGGTCGTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTGGACGACGAAGAAGAGGATGGCAACAGTACGGACGGA
CAGGCGCGCGGCGTGGATATGGTGACAGCTCCGAAGCACGTGCAGTCCACGTCCACAGCTCTTGGGACGTCTTCGCGGCTCAGCGCCAGCAACAGTTTTG
CCTCGGAGGACGCAGGGAATCATTCCGTGACGATGCAAGACTTTGAGATCCTGAAAATGCTCGGAAAGGGGTCGTTTGGAAAGGTCTACATGGCTCGGGA
GCGCGGAGGAGACGGTAAGATCTACGCGATGAAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGCAACCAGGTGGGGCACACGATGATGGAGCGCCGCATC
ATGAGCTCCATCGACCATCCTTTCATTGTCGGGCTCAAGTACTCGTTCCAGACCGCCAGCAAGCTCGTGATGGTCTCGGACTATTGCTGCGGAGGCGAGA
TCTTCTTCCACCTGAAGAAGTTTCGCTCCTTCTCGGAAGCTATGGTGCGCTTTTACGCCGCGGAGTTGGTGGCCGCCATTGGCCACCTGCACGAGCGTGA
CATCATCTACCGCGACCTCAAGCCCGAGAACATTCTTCTTGACGAGACAGGCCATGTGCGACTTACCGACTTTGGCCTCTCCAAAACAGACTGCACGGAC
TTCACAGGCGCCAAGACGTTTTGCGGCACCCCCGAGTACCTGGCACCCGAAATGCTCATTAGCCGCAAGAAGAAGACGGAGTACGGCAAAGCCATCGACT
GGTGGAGCCTTGGGACCCTCATGTACGAGATGCTCACGGGCTGGCCGCCTTTCTTTGATCGCAATATCGAGCAGATGTGCACCAAGATCATGAAGTCACC
GCTCAAGTTCCCGGCTCACTTCGGTCTGAGCTCTGAAGTCAAAAGCCTCATTTCGGCACTGCTGGAGCGCGATCCGACGTATCGCATCGGCTCACGCCCC
GGTGCTGGCGTGGAAGACATTAAGAACCACGTGTTCTTCTCTAGCATCGACTGGAAGTTGCTAGAGCAGCGCGGCGTCAAACCCCCGTTCAAGCCGCGTG
TGCGCAGCCCGACGGACATCCAGAACTTTGACCGTGAGTTTACGAAGGAATTGCCTGATCATGGTTTCTTGCAGCAGGATAAACGACTTGCAGTGTCACC
CAAGAACGAGTTCCAGGGATTTTCCTACACTCGAACGGAGGAGCCAGCATCAATGTCACGAGAGTCAAGCAGCAAGCGAGAAAAGCGCAGGTCAGGGCGC
CGGTCGGAGCCGCGCCTTAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGCTGGACGCCGAACTACTCTTCTGGATCTTCGTAGGGGTGCCTGAT
TCTCTCTCTCTTGCGTCTTGGGATGGGCCTTGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCAGCAGATCAGCAGTATCCCGAATTCGGCCTCGT
CGGCCGTGACAGCACGGATTTTGACACTGGTTGTATCTAGAGTACGTGGAGGCCACCGCGCTCGTCGTGTCCAGTACAAGAAGGAGGCAGCAGGTGGGCA
CCAGGAGCAAGTACATGTGATGATATTCTGTTTCTAATTAAGACTTGGTACAGGTACGGAGCCGATCCGAGTGGAGTCGTTCGCTGGGAGACGTGAAGTA
CGTTGTAAGAAAATGAATGAACCTAA