Description :
From Genome Similarity Track
Location :
contig_60:177802- 203728
Transcript NameFunction/comments
g10707.t1RAW43669.1 Polyribonucleotide nucleotidyltransferase [Phytophthora cactorum
g10708.t1hypothetical protein
g10709.t1hypothetical protein
g10710.t1RAW43711.1 hypothetical protein PC110_g149 [Phytophthora cactorum
g10711.t1hypothetical protein
g10712.t1XP_008907640.1 hypothetical protein PPTG_23251 [Phytophthora parasitica INRA-310
g10713.t1XP_008907639.1 AGC protein kinase, variant 2 [Phytophthora parasitica INRA-310

Sequence
25926 bases(100 bases per row)
TCAGGTCAAATGTTTCTCTTTATTTCTGTTGTGTGGACTCTAAAACACCAAGGAGGAGAGGTGGATCTTCCTTGGTAAAGTAACTACCTACTTGGACTGA
GTGCGCGGGCGACGAGCGGTCTTGGGACGACGCTTAGAAGGTGATGCCGAGCGACGGTGGTGGCCATTGCTCGCACACGTCTCAGAGTCCTCGGAGGAAG
TTGAGGCGTCCTCGCTACCGTCTGCACCCAACAGCACACGACGGGACATTTTGCCGGAAGCACCATCCTGCAGGCACTCGAACTCCATCTCTTGGCCCTC
AGACACCACGTCATTGATATTGCTGATCTTGTCGCGCGATAGCTCCGAAATGTGCACGAAGCCACGCTGGCCATCTGCAGACTCAAGGATTGCTCCAAAG
TCCATCACCTGCGTCACACGCATTGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGCTAGAGCCCTGGTTATCATTGTCACGGCCGTTAT
TGTTGTTGGCATTGCTGTTGTTACCGCGAGGGCCAGCGTTGGCAACACCGGCAAGTTCTGTTTGAATCCACTCGCAAGCTTTCTCCGCGCTTCCGGGTGC
GCCCACGACGCGAACAATTCCTTCGCGGCGATCCACGATGCTCACCGAGACTTCGAAACGCGACTCCAGATCACGAATGTTGCTGCCACCGACACCAATA
AGTGCACCGATCAAGTTCGTGGGAATAACGCATTCCATGCTCACGTTCGGTAGCGAGCTTCCACTAGCCTTCAGGTGCTCACGAGGCTCGGCGAGTTCGT
TGCTCATGCGACGCAGCACGTGCAGGCGCGCCTGCTTGGCTTCACGGAGTCCCTCCTTCAATACCGAAAGCGGCACGCCCCCAGGAAGCTTCACATCCAG
CTGAAGTGCCGTCACACCGACTGTCGTGCCTGCCACCTTGAAGTCCATGTCACCGTAGTGGTCCTCCGATCCAAGGATGTCAGTAACCAACTGGTATTCA
CCCTCTTCGATACGCTTCTCCTGGCCAGCAAAGGGGTCGCCAGCAGTAACCAGGCCAATGGCAATACCAGCCACAGCACGACGAACGGGGACGCCCGCGT
CCATGAGCGCCAATGAGACGCCACATACCGTCGCCATAGACGACGAACCGTCTGAACCAACCACCTCCGACGTCATACGCACAGTGTAGGGGAATTCGGT
CACCGACGGCAGAATAGGCAACACAGCCTTCTCAGCAAGAGCACCGTGGCCGATCATGCGTCGGTTGGTGCCACCCACACGCCCAGTCTCGTTCACGCAG
AAGGGTGGGAACTCGTAGTGCAGCATGGCATGCTTGAGAGACGTAGAAGCATCAGGTTCAGCCTGCTCACGCGCCTCATGCAGAGCACCACGAAGGCGGA
CACCACGTTCGAGAGGTCCCAACGTCACGGAGCACAGCGTCTGTGTTTCACCACGTGCAAACAGCGATGAACCGTGTGCCATTGGCAGCACATCAGCCTC
CATCTCGAGCGGACGCACGATGCGAACCGAACGACCGTCAAGCCGCACGGGTTTGTTCTTCTGACCCTTCGTCTCCTTCGCGATGGTCAGAATGCGCTCA
CGAAGCACACGCTGGAAAGTGTCGTGAGCAGCACGCTGGATGGCAGCATCGTCAATAGGAGGTGAAGCAGCAGCAAAGGTCTGACGCATGCCATTCAGCA
TCTTGCTGTAGACTTCGCGCTCTCCCTGCTGGCGAGCAATCTTACCAGCGCGACCACTTGCAATCAGGTCCTCGGCACCCTTGCGCCCCAGCTCCTCCGC
CTTCGCCCAAACCTCCGGCGGGATGTAGAGCGACGAGTACATACGCTTGCGCTTGCCGTGTTCCGCCGCCAGCTTCTTCTGCTCCTCAATAGCCGGTGCC
ACATGCGCATGCGCTAGGTCCAATGCCTCGTCAAGACGCGCCTCCGTCACTTCATCACCCGAGGCTTCTACCATCACCGCACGCTCAGCAGTACCAGCGT
ACAGCACATCAAGCGTCGCGGCCTCACACTGCGGCGCCGTAGGGTTGGCCACCAGCTGGCCATCCACCTCGACAACACGCACACAACCCACCGGTCCGTT
CCACGGAATGTCGGACATGCCCAGCGCCGCCGACGTTGAGTTGACAGCCACCACGAGCGGGTCGTTGTTCGGGTCGTACGACTGCACCGTGGCCAGCACC
TGCGTATCTTCACAGAAATCGCGCGGGAACAGCGGGCGGATGGCGCGGTCCACCACACGAGACTGCAGCACCTCCTCGTCACTGCCAGTGAACTCGCGGC
GCTTCAGGTTGTCCGGGATGAGGCCTACAGCATACGACTTGACGCGGAAGTCCACCGTGAGCGGCAAGAAGTCCCTTTGCACCACTCCGCCATTGGCCGA
GGGGTTGCCATTGCGGTCACCACTCACGACCGTTGTGAGCAGCACCGTGCGGCCGCACGAGGCCAGCACGGCGCCGTCCGCGAGTTTGGCGAGCTTGCCC
ACAGTGTACAAGGTGTTGTCTAAGCTGCCGACCACCGGCTCCTTCACCTTCTTGGGCTCCGGCGGCTGAGTCTGAGTCTGCTTGGGCTCCAGCTGCTGCT
GCTTGTGCTGGTTCTGCAGCTTGGCGACCTCCTCTTCCTCTGGCGACGGCTTCTTGGCGCCGAACAGCAACTCGCGCAAACCGAAGAACGCGCGCGCCTG
TGGCGCTGCACCAGCGATACGAGGCACGCGTTGGCGAGCTGCAGGGATGGCGGCGCGGCGGGCCACGGCCGCGGCCGGCAGACGACGAGCAGCAGTGGAC
AGCATCTTGGTCAATGTGTGGCTCATGCAGCAATCATTGATTATGCTGTGGTGCACACTAAACCATGTTCTGACACACCACGCGAAACCAGCCAACCGTC
TTTGTTCAGCTATTCGACCAGCACAAAAACTTTCAACATCAAAAACAAAACGCTAGGTTTTTTTAAATCGCAAGGAATTGCACCATCCGTACTGGTCGAA
TAGCTGGTTCCTAGAGAACGAAGTGGACCCACACAATCAAAAAGCTCAGTCCGTCCGCACCAGCAGACCGTACTTGCTCCCCCGCCCTCCCCCCCGTCCT
CCAAGCCTCCAGACTCTTCAGCATGGGCACTCGTGTGTACGTGGGCGGCCTCCCGCGCGACGCCACTTCGCGAGAGATCCAGGACGGCTTCAACCGCTAC
GGCCATGTGTCCAACATTTGGGTGGCGCGTAACCCGCCCGGCTTCGCTTTCGTGGTGAGTTGAGCCCCTTCCCCTGCTGCGCGAGGCCTCGCATGATGGC
CCTGTCCTCCCTCTTTCTTCTACCCCCCTCTACCTCTCGGCGGCGACAGTTTTCCAGATCGGCAAGCGGCGGTCGGTGGCAACTTGTGTATGTTTTGTAT
GTGGTGTCTAGTACTATACATGTTGGTGTATACGCTACCGCCGCTGCTTCCATCCGGCCCTCGGTGTAAGATGATTGTTGTCCGTCTGCTGCCCGCCGTC
TTCGGTGCTTCCTTCCACTGCCGGAGGGAGAGATAGAGGAGACGTCGCTCTGCCGACGATGGTGGAGCCATCATGCTGCGCCTCGCCTCGCCTCGCGTCT
ATCGCCATCTTCATCTTCGCCTGCAACGAACCAATACCAACCAACGCCTCTCCATCGTCGTCCTCCCCCATGCTGCTGCTCCCCACCTCTACTCTAGGAC
TTCGAGGACCCGCGTGACGCTGACGACGCCATTCGCTCCATGGACGGCCGTGACTTCCTCGGCGGACGGTACGCGCTGCTGGGTTAAAGCGACTGTAGTC
TACAATACATCTAACTCTTGTGCTGTGAGCAGCATTCGTGTCGAGCTTGCTCGTGGTGGCAGCCGCCGTGATGGTGGAGGTCGCGATGGTGGCGGTCGTG
ATGGCGGTGGCCGTCGCGGTGGCGACGACGACCGTGGAGGAAACTTTGGTGGCGGTCGCGACCGTTTTGAGCGTGGTTAGTATACGCTCCAGCCAGTGTC
GTTCTCGTTGGTGGACTGATCAAACGTGTTGCTGTGTGAACAGGCCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTG
ATGTGGACTGGCGCAACGTTAAGGACTTCCTGCGCACGGGTGGCGAGGTTACCTACTGTAACATCGAGGCCGATGGCTCTGCGTATGTATAACAAACCTT
GGTGGGCTGATATGCTTCTGATCCAGTTACTAATTCTTGTGTTATTTCTTTCGATGCAGTATTGCTGAATTCCAGTCCAAGCAAGACTTGGACGACGCCA
TTAAGAAGCTGGACGACACGGAGTTCCGTGGCAGCTATGTGCGCGTCGCTGCTGAAGGTGGAGACTCTGCCCGCCGCTCACGCTCTCGTTCACCTGCTCG
TGGCCGCTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGTTGCCCGTAAGGACTCCCCTCGTCGCTCGCGCTCCAGATCAGCGTCGCCTGCCGCTGCC
CACTCGCCCTCTCCTCGTAAGGAATCGGCTTAAGCTGATGTGGATCGAAGAAGGCTGCAGATCTGCATTGGTGCGTACGCTACGCGGTGAGAGCCGTGAA
GGTCTTTGCTCGCTCACGTGTACAGTGGCTGGCAGCTCGACCAGCTTTGTTTGTTGCCTAGCGTCCCAAGGAAAACAAGCACATTAAACGATGGCAATAG
CTTCCTCTTATCATTTTACCCTAGTGTTAACTCTGTTCTCTAGCGTGCAAATCAATTCGCTGAGTGTCAAAGCCACATACAAAACCAACCTCACCAACCA
AGACTCATTCAATTTTCATGACTGCCTGTAGAGTCCTCAGTGTTAACTCCCAACATCGTCAATGTTGGGAGTTACTGAACTCTCTCCGGTATCTTGATTT
CTAGGATGTCCTGTGAGCTGCACGCTGTTCTCTCCCAGCACATGAAACCTGTCAACATCATGGCAATCAAAGCCGAGAAAGCGACGCCGAACGACAACAA
GAAGAGGGAGACCTGCTGATGAAGGTGATGGTATTTGTGACTCCTGTTGCTTTCCTCTGCTTCCACCCCGTGAGCGGACTGCAGCGGGAAGCTGTTACGA
GAGACACCCCTGCCGTGCTCTGCAGGCCAGTCCTCTGCTGATCTCCTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGA
GCTTTATTATGCGCCGCACTTGCACGTTGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTAGTTATGAGAGATTCATCGTAAGTCAAAGATTCCTG
ATGCCGTGGAAGGGAGCTTTCGATTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTACAGGTACT
TGGAGCAACGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGGGCATCTTTTCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTC
GGTGATCTGCTTCGGCTGTGGACAACGCAAAGCACACATCGGACTGTCGTTAGCGGGCTGCGGGTCCATCTCCCTAGCTATCGCCGCATATCGAGACGCC
TCCGTACCATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAGCACTAGCACAGTCAACACCAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCAC
GCGCCTTTGGTTGGCCAGCAGTCTCCTTCCGTAAAAACTATTTACGCTATCGACGCGTAATTACCTTCGTAACCCCTGATGAGGTACGTCGTAACTTGTA
TGTGGCGCACACCACTCGCCGGCACGTTTTTAAACAGAGCGCTACACTTCATCTCACTATGGACGTTTATTTCCTCAGTTGGAAACGTCCATCGGAGCAG
CTCCAGAGTCGAAGATGGCGTCCAACCAGGAATGCCACATCTGCCTGGAGGAGCTGCGTCAAGACCTGGTGGCCGCGCCGTGTGGCCACGTCTTCCACCA
CATATGCATCTTGCAGGCGCTGCAGGTGAACACCCAGTGCCCCATCTGCCGCCGCCGTGCGGGCGACGCGGACCTCATCACGCTCTACTTCGATGTACCG
GGCGATAATGAGGCACCCGTCAGTGAACTGCAGCCGCTAAAGGCCTCGGGGGACAATGTGGAGCTCAGTTCGCGCGTCAACGCACTGATGGAGCGCATCC
AGTGGCAGAACAAGCAGCGCGAAGGCATTTTAGGCGAACTGCAGAGGGTACGCAGCCAGAGTAACCAGTTACTAGCCGACAAGCAGGCTCTCGCACAGCG
CGTCGGAGCGCTGGAAGGAGCCAAAGTGGAGCTACTGACGAAAGTGGCGAGGTTCCAGATGGAGCTGAGTCGCCAAACGGAAGCTGCAAGGCGCTCCAGT
GTGAACCAGAGCATTGTTAGGTACCTGGAGACGTGCGACGCAACGGCTATGGAGGAGGAAATCCAGAACCCCAGGGAGCTAATTATGGCGCTGAAGAAGG
CGTGCAAGTTCCGTCATGACCAGTATCAGAAGGTGGTGAAAGAGAAGATGAGGCTCAAAGAGATGCTGAAGAACTCCCAGCCACAACCGACAGAGCATAC
AGGGAATAGTGCAAGGTCGGGTAAAGCCAAGGTTCGAACAGCGTTCGAGACCAAGCGTGCATATCCAGCAGCAGGTAACGACGGAATGGCGTTCGGAATT
GGCGGCCAGCCGCAGTTGGTGGAGAACAAGAAAAGGAAAATCGACTCGGCGTCAGTGGCATCGAATCCAATGCCACTCATTGACAATGACGATGATGTGG
GTTTCACACCGCGCTCTGAGTCGGCGGGCTTCCGCGCAAACGCCTACTCGGACGTATCGATCCGTCCGCCTCCGAGTTCACGGCAAACGTTTGGGCGCAG
TAGCTTCAATCCGAACCAGTACGGAGCTTTCAACCTGTCGCCAGCAAGCCAGCCACCCGTGCAGATGGCAGGACTCCAGGCTGCGGTGTGTCGTCGTGGC
TATGATGAAACTGGAAAGCTCACCAACTTTTTCCTTCCATTGGGAAAGGAGAGTGATTCACGGTCCATGCCTCGGACGAAACCCATTCCGAGCATGCAAA
ACCTGCTGAACGCACAAACAAGAACTTCGGGTCAGCAGCAGCGCATGGCGAGCAACGACCGACAGGAATACGCACTAACAAACTGGCTGCGCAATAACTG
AAGGAGCCGAGGGGAAAGCCCGAGGTCGCAAGAAGGCTCTGAAATTTGCGGTCAGAAAGCTGTGTACAATACGATACTATTTGCAATGTTAGCGGCCGAC
GATTGTCGTTCGCCCTTTAAACTTTAAGATATTTTGCTTTTGCTTTAGCGCTTTTCTTGAGAGCTATGGAGTTGGAAACGGAGGTTTGTCAGTGTTGCTT
GCAACGTGGCTTGATGTTCCTTGATAATGTTGATGACCTCAGCGTCTTGGGTTGGGAATTTCTTACCGGAAATTAGACGACGGCAAATTTCCTCGATAGA
TAAAAACGAAGTGTCTGGGTTGCTGCATTCCACTTCTACTGATTCAGGTTCAGCTAGTGCTGGGTCAGCGTCGGCCATAGCGGTAGAAGGTTGCCCAATA
CTTTCATCTGGCTCACCGACTTTGTCGCTTGCATTTTGCCGTGAAATTGCCACAGTTTTCGATCGCCTCCTTCCAAGAAATGAGAATTCTACTGGCTCCG
GAGGTTGTGGCAAAGGCGAAAGCTGCTTGCAGACATAGTAAAGAAGCGTCGCTAAGTTGGCCAAATTCGCTGATGCCTGCTTGCCAATGCTCTTGGGGCC
AATACCAACATTCCAAGGTTGCAAGATGACATGCGGGATCAGGATCCGCACAAGCAGAAAATTGATCACCACTACGTTGAAGCGCAACAGACTACCACTT
TCAACGGAAACCATTTCCCCACTGCGACCATGCTCATCTGAATCAAGAAGGCTGGTTCCATCAAAATCCATTCTCCTGGTAGCACCGAGGGGGTCAAATT
CGAGACTGCGCCGCTCTTCGTCAAATAGTTGGTACTGGATCGAAGTACATCAGGATCATGGTCAGGTCTGCCAACAACTACAGTGGAAGTTACTCAACGT
ACGCTGGGCGGGAAGTAAACGCCATCCGTAGAAATCCGCTTCCAGAAGTCCATGATGCCAAAAGGGACCTCCTTCTTATCGATCGCTTTGCCCAGTGATT
GCAATACTCCTCTCATGTGCACTTTCAGCTTTAACAACTTCGCTGGATCCACAGCACTATCAATTGGATGCCCGTTACCCGCGAGAGGTAGCGCTGGTAC
AGGGGGGCGACGAGCAAGGATGCCACCAAATTTCTTAGCAAAACCTCGCAAACTTGACCCCGCAAGACCATTTTTCGTGCTGATGTCCACGTCTACACTT
GGATCCTGAATCAGTGAAAGCAATGGAGTTCTTACCACCTTTCCAAGCCACATGCGAGTGGCGTCAAAGTACACACGTAGCATCGCCTCAAAGTCCTGAG
CAGATTTCGTCAGAGGAAGAGTGAGATGTTAAAACCTTAAACGGTATGTGTTGTGAGCATACCCGGATTGCGCTCTCCTTTTCAGCCATTTTCTTGTTCA
TCAACAATTTTTTTAGACACAATGTGTACATGACAGCACGTACAGCGGATCGGAAGATTTGAAGAGGTTCCATCGCTTCAGCATCTTGGAACCCGAAGGG
TGACACCTCATCGCTTTCAGCTTCAGACTCTAGACGCCAGCGTGGTTTTCGTAGAGCGCCGCTGCTTGCGTTTTTAAGAGAAGCATTTAGCAGTGCCTCC
AATCTCTTACGGCTCTCAAGGCGCTCTCGTGCTTTTTGCTCGTTTGAGGTGCTGGTGTTCGCACTCACTGTGTTTGCAGTTGCATCACTTTCCTTTGCAT
TGTTACTGCTACCAACCACATCACTTCCTGTAGCGATATCCTCATCGTTTTCAAGTTTACCCAGGGTCTAAGCAAAAAGTGGTTAGTATGGTGAGCAAGA
GGCAATTGGATCAGAGGCGCACCATTTCATCTTCATCCGTCCATTCAAACTCGGGAAGCCATGACAGAGGAGATGGAGTTTGCAACGTTGAAGAAACTTT
CCTACTTAGAGATGCGCTGTGTGATTCTGGCTGTATTGTTGGGGTAGATGGCTCCTGCGCGTCAGTAAACTGCATCCATTTAGTCTGTGCGTTAGCGTTT
TCCTTTGTGGGGGAATTAGGAGACAGTGGCGGTTTGAATGGTCTCTCCGTGCTCAAAACATTATCAGCATCACTTCCACGCATTAAACCCAACAAATCAG
CAAGTCATGATAAGCATTACGCACAGTAGAAGAAATGAACATATACACGTACTGCCTTCGCGGAAGTAACAGTGCCATGATCTGTTCGTTTTGGTGCACC
AGTCTCTCAATAAGGCGCTCACTTGACTCGGGGAAGCGCTGATCAAATCGTGTTATAGGTGATGTTTCGAGTGCCCCTCCAAAACCGAGACGAGGAGAAC
CTCTTTGTACTGGATTACGTGTAGATGCCTTGAGCTTGAAATCAGCAGTTTATTGAGCACAACAGACCTTCAACACATGCAAGACTGTGTCAAGCTGTCC
TCACCTCATACTGGTCAACCTGCATCTCAAGCCGCTTCACTTGAGCTCTGTCGAACATGTCAACACGACAATATCTTGCCTCAGATAAAATTCTGTGCCA
GATACGATAAGCAAAGCCAGAATCAGTACCTCAACTCTTCCCGGCGTTCTTTGCGAGCCGCGATGAGTTGTTGCTGACGCATTCGCAGCAATTCATCCTT
TACCCCCTCTTGACGAAGAGAAAGTGCCATGCATTGTGGCGCAACTTGATGTAGCGAGTACATGTCACTCCTTGGTCCGGCGTGGGGCATGCCCACGAAA
TCGGGAGTTGTCTGTCTTTTTTTGGATGCATCATAAATGGCTCATAGACAGACAACTCAACTCGTGAACGATCAGACGTGAGACGAACAGCGAAATCTGT
GTATTTCTCCGCTGGAATGTTTCTTGATCAACTCTCCGCTGTCACTTGGTCCTGCTTATCAAGAGTATCAGTAGTGACAGGTTTGTCAGCTTCAGTGGCA
TTCTTCTGCTCCTCCTTCTGTTTGCCATTGGCTTCTTGTTTTGCGATCTCCTTGCGTGCCGCTTCTTCTCGCCCGAGAAAATCGTTAGTCAAAGACTGCT
GCAAGTCCTCGATTTCGTGGAAGACCTCCAGTGATTTCTCCAGGATCAGCGTAGCAGACTCCAGCGTGTTCTTTGATGCCTCTAAAGTCATGTTGGTAAA
CAACGTGTTTGCTTTGAAAGAACCTTTCGCCATCGTTGCCTGGACACCACGGATCTGGAACATGAATGCGGCAGACAAATGGGGTGCATGTAAATACAAA
TAGTGTAGCAGGGCAAAGAGCAAGCAGCATATCGACATCTAATGCTGTTACCTGATCTGACAAATCCCGCACTCGCTTTGAGATATCCCCGTAGCGGCAT
TTCATCTTGCCACAAATCACAGGCAGTGAAGCCTCCGCATCACTGATGTCCACCACGCCGGGAGTATGAATTCCTTGCGCTGCAACACGATCTTCCTCCG
GAACAAAGGTAAGCAGCGACGCCTTGAACGTGCACATGCCCGTTTTCTTCAGTCCATACAACTTCGTGTCCGATTCCGGATTGCTGGAAGGAATAAGCTC
CACAGTCATGGAGTAGTGATCGTTGTCCATACACTCGTCTCCGTCGTCATAGATCATGTATTTGTAATTCATCGTGATTGGATCAATGTGCCAGCCGCGG
AAAATCCTACAAACACATGGAGCATTCAATCAGCGCTTCTCCTTCCATTTGCCAATGACCTTCAAGTCTACCTTACCCGAGAATAGTGGGAATTTCCGGT
TTCTCTTTCTCCTCTGACACTGGTTCTTCCAGCTTCGCAGATGAATCTCCGTCCTCAGTCGTGTCCGGCACGTCCGCAACCACTTCCACCTCCACCTCGA
CTTTCTCCTCGATCTTGGCCTGGATTGTCACATTTGCTAGGTGGCAGAAATCTAGAGTATAGCTGCAATAGCGTTAGATGGGTTGGAGTCTCTTGTAAAA
TAGCGTTGCGAAGAGCGTTCTGCCTACGCTTTGCCCTGCTGCATCTCCCTCTCCTCGCGAACGCACGGCAGCGACTCGAGTTCATCAACAAATGGTCCTG
CCTCACGTAACATAAGAGGAAGGACGCGCTACACGTTAGATATTTTACATTATTTCACACTTCGTCGCATCGCAGACTCGCCTTGGAATGCGGGAAGTGG
ATCGCGGGACGGCACCGGCAGCAGCACTTGCGGCACCTCCTCTTCTGGGCGCGGGCGCGGGACAATCCGGATGTCGACCTTGGGCGCTCCTGTGCACAGC
GTGCTGCTTAACGCCACGACGGCCATCGCACCGGCGAACACGCTCCTGCCCCGCATACTCGTCGCTAGCTTGGCAATAATTGCAATAAATGTGTTTTCGC
AGGGTTACTTCGTATGTTACATTTCGTCGGGTATGTTATGATACAGGTTGTATAACTATTGACAGGGATTTCGCGAGTTGAAGATGTGGAGTGATGGTCA
TCAAGCTTCGTGCGGAATGCGCCGCTCAGTGCGGAATTTGCCGTGTCGTGAGCAAGCGACCGAGTGGAGATGCAGGAAGACGGCGCCGCGGCGATTATGA
GCGGCGTGCACCGGGCGATAGAGCTCCTCGCCCGCGCTGCAGAAGGCTTGACGGCTTCACATGACAGTCACCAAGTTTCCTCGACGGATATTGATGCCTT
GAAGCAAGTACTCGAAGAGCTTCAACGCCTCATCCTCGAAGTTGGATCGCAGCGTGTACTGGAGCTGTCGGGGGCGCAGTTGATGAACGCTGGCGTAGAG
TTGTACAACGCGCCTCGAGCTGCTCTTCGAGCTCTTGAGCAAGTAGAGAAATCCAAGACGAAAACCGACTCAGAAGCTACGAGCTTACCACGGTATTTGT
TAGCGGTCACGCGATTTGTAGCTGCGAAGGTCATGGAACTCTCATTGGTTTGCTCCAAGAACGGCGGTGGTCAGGAAAATGGAGCGAGGAAAAACACGCA
GTTCATGGATGAGTGTGTCGACGTGCTGCGCTCGTTTGGACGAGTGGGAATGTTCTTGTTGGAGAGCGCATCAGTTGACTGTGAAAACTGCGAAGCGTAT
TTGGAGCTGGCAAATGAGGCCTTTTCTTCTTCGATGAAGCTCTGGTCTCGTATTGGCCTCGCTCATTTGACAAAATTTAAGCAAGGCGTGGAGCTGGACG
ATGTTGTGGATGATTTGTGGGACTTTTGTACCCATCACGTACGCGTGCTCCAGCTGATTTCACAGCGGCCTGACAATTCAGCAGGAGAGGCTCGAGATAT
TGTGTCATTGCTGAATGAGTTGAAGATGCTCGCTCCGTACAAACCTTCGTATGCCAGCAGCTTGCTTGATCTCATGCGCAGTGTTAGTGATGAATACAGT
CAAACAGCGCAGCACGAACTGCAGGTGGTTTTTGCCGAGGAAGCGCTGCGTGTGAGTGAATCGCTTGAAAATGATGCAGACGAAAACTTTTCGGAGCTGG
TTACGTCGTTCAAACAGCATGTGTTGCTGAATTTGATGCAATCTCTCTGCGCTAATAATGACATCGAGCGAGCAGAAGCGTGTTACCAACTCATTCCAGT
TAATCGGAACTCCAAGGTCCTTCTACCCATGATTAAGCTCTACGTCGACAACGAACATTTTGATAAAGCACATCGCCTACTGCTGTCGTTGTTTCAACAA
GACAACTTTGACGATTCCATCTTGGGAGCACGCACATACGCCCAGGGGCTGTCTTTCTCGATCAAAGGAATGGATATTTATCGACACCTAGCCATAAACT
ACGGGGATTGCGCGCATGCCATCAATGTGGAGATCGCATGCAATCTTGCTGTGGAAGAGAGCAACCGATACCGAGCGATGTCAGAACTCAAACGCATTGG
CCTCGAATTGCTCGAGATGGAACGGTAAGAAACCATTGGGTAATCAGACCGGAATATAACGTCTCACTTTTAATTGCATATTACAGCCTAGGTGAAAGTG
GTGATAACAGACTTGTCCAGCGGGTTCAACAAACCATTTTTGATGCTCTTCAACTCGCACTTAATTCCAACCAACACGAGGTAACGAATCAATAATGGTG
TGCAGCGCGGCCAAATCGACTCAGTTTCCAGCTTGTAGGACTGTTTGAAGTGGGCGGATGCGGGATTGGCTTCGGCGTCATCAGCTGATGATAAAGCGAC
GTACATGAGGTAACATTGATTTAGAATGCGTGACCACTACATCAAACATTGATGAAAGTAATGCTCTGTAGGACGATGTCGCGTTCTTGCCTCCAGTTGG
AACGCTATACTGAAGCTGGGGAGTGGGCAGAGAAGGCGTTTGCTGAAGAGCCTTCTAAGCAATCTCTATTCACTGTTTTCCAAGTGGCTCTACAAACAAA
ATCGAGTGCCTCAAATGAAGAGCTGGTTCACATTATGGAGCAACTAAAAGGCAGGGATGATTTTGAGATCGAAGATTTCCTCGCCATGGGAAAGCTGGCT
GATGATCTTAGCCCAGCAAGACAAGATATCGTGATGCACGTTCTCGACGAGATTTGTCGCACGATGATGCAAACTGAGGACTGCCCAGCTAATCTGCCCA
AGGAAGTCATCCTACAAAATGCAGCGCAGCTAGCATTCAGCACGTTCGCTCAGCGGCAGACTGAGCCAAGCCCTGCTTCAAGTATAATTTCCTATGGTGA
GAAGTTCCTGGTTTACGCCTCTGCATTGCTGCAGTCATCAAGACCGGGTAGCATCGGCAATTTAGGGCCTTCTTCAGTGTTTGAGTGGTTCTATCGAATG
AGGTACGACTCAGGATTTCTTTTTACGAGTTGGAATTGCAAACTCACAGTGGTTTCTTGATGACAGCTTTGACATCGCCAAAACCACCGGAGACGCCAAG
TTCTTTATCGTGGCAGCAACATTGCACAACGCAGCGACGAGCTGTACGGAGAACAATCCCCACTCAAGCAGCGATGCCAGCTAAGTTTGCTGGCAACGGT
GAGCTCTGACATGAAAAATATAGAGACACTGGGCAAGAGTCAACTCTTGCGGCTTCTTGAAGTGATCGGTCGATTTGAAAGTATCGCTTGTGGGGACATG
TACGCCAGTGCTGATGTGAAGATCTACTTGGTACGAAGTATGTTTTTATGCTTGTAGCAAGAGAAATGCTGTTCACCCTGATGATTTCTTGTCGACAGGC
AAAGTCAGTGATAGCGGTGAAATTGCGGCTCTTTGACGCAAACACGAAAGCAATTCTTGATCTCTGTAAGGCCACAGTGCACAGCGCCACTGACCTCATG
CAGATTGGAGGTGTGGCAGACGCAGATGATTGCTACCTCTCGCAATTTCGCTTGCACTAACACTGTGTTGAAGATCTAGTGCTGTATGCTACAAAGTTCA
ACGAAGCATCTGAAGTACGGTTTTTTCGGGCTCAACCTGTAGACAATTACACTCACACGGCTTACTTGAGCAGATTCGAAGCAGCTATCGATCACTTGCC
AGCGAAATATCCAGCTTCGGGTACCGGCTATAATGTGTTCATTCAGCCATGCTATTGAACACAAATTGCTCACCCGAATAACGTATATCGATCAAAATGC
AGGCTCCAAATGCTGGTCCAAGAGGATTCCATTGACGCGAACAAGCTGTGCTATCTGCTCCGACGGCTCATAACGCTAGCTGAATCGAAGACAAAAGCAT
ACGAGTGCTTCGACCAACTGATTCAGTTCATAGACACTTTGGACGTCCCGCTCACTGAAGTCGACATGGAGTGGTTTGTTGTCAAAGCGTGGAACATCGT
AAGTGAGCTTGTTGATCTCGTCCAAAAGAAGTTGTACTTCGAAGTACTAACCTACGCAATATTTGTAGGGTGTGTCCTGCCATCGCAGCAATGACGCAGA
AGGAGCCCTCCGGTTTACAAGGACTGCTCAGACCATAATGCGTAGGCAGATACACATGAATTTTGGCCATCCAAATTGCAGGCTAACTCGTGTTCGTTGA
TTATGTGCAGAGCACAGCGAGTCCCTCGTTGGAAGGTTGGGCAACAACCTAGACGCACAATACCAAACAATGCTACGAATGAGTTCCCTACCAAAGATTG
GCGGGTAGTCAGCGCGTAGCGCCCTAGCGCCCAACAGGATAGCGACTTTATCGACCGAGGCAAACAGCGTACAATTTACTTCCCCATTGCTTATGCCTCG
TACACGTCAGGCGGAGAGCCATGACTCGATACTCCACCCATGTGCGTCTTTATAGCCTCCATGTAGGTTCGCAGTGTAGGTAGGTCTGTCGTTTCTTCTT
TCTTTAAGACCTTCGAGGCCCACTTGCGCTCTGCATACTCACAAATCTGGAAAAACAAACGTAAGCGACAAGTTCGCAAGGTCAGCGTTCACAGTGAGTT
CTACAAAACTGGAAAATGATAAAGAGTTAAACCCACCTCTTTGATATCTCGGCACGAATGCTGCGGTGAGACAGTGGCCAGCTGCGAGAGCTCCTCGCCG
GAGAGTTGCTTAGCATAACTGCATAGAATAGGGAACACCAATACACTGCTTATAAGTTGTCTGCCAAACCACAACTTCTTCAGTGCAGAAGCTTACCGAG
AAAACACCGCGCGGCGGGTCTTCTCGTCAGGAAGGTTGTAGCGAATGCAGAGATCAAAGCGACTGATCAATGCGGCATCCAAATCCTGCTTTCTGCAGCA
TAAAACAGCAATTACGTTTACAGTTTAGCAACCTCCCGATGCACAGAAGGCATCATCTGAAATTTAACAATGCATATACCGGTTCGTAGCGCACACAACC
GTAGTCTTCTTAGCAGATGCAAAACCTTCCACTTTTTGCAGTAGAACCGACAAAATTCGACGCGAAGCCTCGTGCATTGTGCCACCAGAACGGTCTCCGG
CAAGGGCGTCAATCTATTGCAGACAGCAATTCATAAAGTATCAGTAATGTTAACGCTGTACTTCAAAGTACACCAATAGACAACCAATGGGGACACGCAC
CTCGTCAATGAAAATAATGGCGCCATCGAGTTTCTCGCACGCGTCAAAGATCGCAGACATCTTTTTTTCGCTGTCGCCGTACCACTTGGACACCACACTC
TCAATTGGGATATGTATCATTGGAATTCCAGCCTGCTGTGCGATGATACGAGCACTCAATGTTTTGCCAGTGCCCGGAGGGCCTTCAAATAAAACAGCGC
GTGGACGATTGCTTTCGTAGCGGCAACGGGTTTTCTGCGCAATGCGCTCGTAAAGTTCTGGGTTCTGAAGCGCCAGCACAACCGTGTCTTCGATCTCGAG
CTTCACGTCTTCGTATCCAGCCTAACCATACAGAAACATAACCAAGAGTCATAATTGGTAAAGCGCTACTGCTGTTTACCCCTTTTCAACAAATGCATAC
CAGACTCTCCCAGGTTAAACCGATTTCGCTTTCTGTTGGCTCGAAGACATCAATACCTAGCCCTTGAAGCTGCTGGATTGCTTCCTCCTGCAACCAAAGC
GCACCATGTGAGTTACTCAAAGTAGGACTACTAGCAAAAACAACAAGCCAACAACGGACCTTGCTGCCAGGGGTTGCTGTTGTAGCTGTGGTCGGATTTC
TTCCACGTCCAACAAGTGCGTTCCTACGCCGCTGCTCAAGGTCATGACGGAAGAAGGCGTTCACGTTCGCGTACGAGTAAATCTCCTTGTAGGCACCAAC
AATAGCGTCGATCTCGCCTTGCGTGAGAAATTCATCCTTGTAGAAAACAAACTTGGATGTCGCTTGCAATGAAGACGAATCACGCAAGAACTGGAACGAA
CCAGAGCCGTTCGTGTACAAGTACGTCACAGCAGGCTGTTCGTAGGCCTCCACCACCGACTTCTTCGCGGTGTTATCTAGCGGCATCACCTCTACCGACT
GCTTGGAGGCAGGCGTCGACGCCTTTTGCAATTGCAGTAAGAAGCGACCAAGGATAGCTTCTTGGTCCACGAACGTCGGACACGCAAACTCGATCCGGAT
CGTCGACACGCCGTTGGGCGCGTGATCTTTGAGATGCCAATCTTCTTGATCGGAAAAGCCTTCGGGATGCGCGTCTCGGAGCTTTTCAGCGTCGTACGGA
ACTCCGACACTTGCTGGCGAATGGTATCCACAGCTTCCGCGTACTCAAAGTGCTGCAAACACAGTCACAAATGGAGCATTTAGTCTTCCTCTCACGATAT
ATCTAATACTTCAATAAAAGGTTCCTCCAACCTTCTCCTGCTTCTTGTCAGGGGCTGCCTCCAATTGTGTCGTGTCCGCATTCACCCCCACAACACCAGC
GAGAGCTGCAGCAACAGCGAGCACAGCGAATCTATTGGGGCCTGAGTCGCCAAAGGCCGCCACGACGCTCAGAGGCCGCAGCGCTTGGCTGGAAGGAGCT
GCAATGCGACATAGAGAGGCATCCATGGCCACTGGCAGCCGCGTGGACTGGACCACGGCGCGTGCTACGAGCTTGACGGCGAGCCCTCGCTGCATCCTTT
TGTCTCGGATTCTCAAATAGAAGTAAATAGTAATACCTAGGTTTCAGTAAATGCACAAAATTGGGACAAAATGCTATGTTCGAATTGAGTTTAACAGTGA
CTCTGATTAGGAAATCGTGCTGTCATTTTTCTTGCGACTTTATCAATTGATACAGGTCGAAGTGACGATCACATATGTAAGGGATTTTACGGGTTTACTC
ACAGGAGGTGCATGTTGTGCGAGGAAAAGCGATATTTGTATTGAATGAGTGAAGGGAAGCAGCGTCACTATTCGTGACTCACTAATGCTTGACCATCTAG
CGACCACCGCGCACAAACACTTTTTTTGGTGGGGTCTCGGCAGCTTTCTGCTCTTCGCCTTCACACCGCTGTCGGAAGGTGGCAAGCTGTCGTCTAAGGG
TGCTGATCGTCTGGGCTTTCTGGGCAAGAATCTGGCGCACGTAAAGCGTCGTCGTTAGATTTGTAGACGCCATGGCAAAGCGCTCAGGTACCTACCTCTT
CCAGACGCGAAACATACTGCTCAATACTCGCCGAGTCGCCAGTAGCGTCGTTTTGAATAGCTGCTAACATGGCACCTTCCTCTGTGAGTAGCTCTGCATT
TTCCTGGACATATCCATCAATAGCGCATTAGGCACGAAATAGCGCAGTTCTGTTGCAGACAAATAAGAGTAACAAACCTGAATTGCATTCATGTGTGTGC
TGAGCAAACCCTCCTGCTCTTCATACAGAGTCTGAACCTGTAGTCATGCACACACTATTGTCAGCGTTGCTGTCCCTTTCAGCACATACAAGTTAGGCAA
CAAGCTTAGCATTACCACTCCCTGCCACGCTTCCTCTGAATATCCGCTTTCCAAGGCAGAACCACTTCTTTTGTCTGCTTGTACAAACAGATTAGAGCCA
TGTAGAGGATAATCGCAAAGATAGCAGCGTACCCGAATGGTGCCGACGACTAATGCGGAGAATGCTCAAGTCGTCGCTCAAGTCGCGCGTGTGATGCGAG
GAAATTGTCACTACATCCCTATTCCCACCATCAGCATCGCTCCTGTACTGATCACCACCGCCTTCGAGCATGTCATTATCATCGTCTTCTTCTTGACATT
CCTCTTCCTCCTCTTCTTCTTGCTGATACCCGTCTTCGTCATCAAACTCCTCAGCATCGTCACTCCCATCTTGGTTGGGATACGCGTCGTCACCGTCAAG
ATCTGTTTACGGCACAACGTAACCTCAACATTAATGTTCATCCCATGGTAGCGATTCCACGAGTTCACACGCACCCTCTTCAAATTGGACGTCTTCGACA
CCCACAGCATCAGACTCAGTATTCCTCTCATCAAAGGCATCCGCAGAAACACGCTTCTCTTTGACCCGATCAGCATAGCGAAGAGTATTGATCGTATGGT
CCGAGGACGAGGCACACGGCGAGACAGCGGCAATCATCACCGTCCTATCAAACAGAATTCAATCAGTTGCAAAAGCTGGTTGGTGCTGGATATCTTCAAC
ACGACTTACTTCGCTTTGGCATTGACAAACGAATCTTTTAATACTTGGGTGAGCTTGCTTGCTCGAAAAGGGATATGAGTGCCTCGACCACCACTATCCA
GCGCTCTATTCATCACAAAAATGCAACGCAAATGAAAGGATTAGGAGACAAATCTTAACCGGCCGCCATTTATAACGTACCGAAAGCACTCCTTCAAGGC
CAGCAAGCTTCGATTGATTTCCGCAGACTCCAATCGTCGCTGCCGATTGTGATTCTTTGTATCTTCACCACGCTCACTACCCGCAAGATCGATCAATGAC
AATTTGCCGTGGAGTTGCCCAGTTGCTTTCTCACGAAGATTGATCTGGCAGATGCAGTGTGATCGCGATGAAACATCATTCATCTCCGTGGCATGCGTCG
TGCGAAGACTGTTGCCTTTGCTGATCACTTGCAGCAGCTCCTCAGTATTCTGCGGTTGTACCTCCTCCAAATCCACAATCTGCACTTCGCCTGCGCCATC
TTCACGAATCGTCAGCACCTGTCGATGCAACAAATCCTGGCATCGACCACCATAAATCTCAAAGAAGCTCACGCAAATATCCAAAGGATATCCGCGTCTT
GCGAAGTCGTCGGCCTGCGCAAACACATCTGCCGCAATCTGGCTCTGGATGCCTTGCATCGTGTGCGTCTTGCCACTACCCGTTTGTCCGTATGCAAACA
CCGTAGCATGGCCTCCGTCATGGAACACAAACTTCACGAGCGGTTGAGCTGTGCACATGTACACACTCTCATTCGTCGCATTCTCATCAAAAGTCTAAAA
ACAATAAACAATTATCAAACACCAGTCCACAACCTCCATACCTCACCAAAATGCCCCGTACATGGTCGAAATTGAAGGCGTTGCTGTCCAGATACTTGGT
GATACCGTCCACCTTGAGCTTGCAGTAGTGCACGATGGACATGGGGTTGAGACACGTGACGGCGTCGTAGTCGTGCTTCTTGACCTCTTTGGCGTTCACC
GGCCGCTTGCGCACGCAGATGGTGATCTTGGTGTCCCCCGCCTCAGCGTGTGGCCGGCTGCGGTCCTTGTTCTGCTCCCGGAAGGCCTTGATCATGCGCT
GGAAGTCCACGTCGCCCGGGTGGCCCATCTTCTCGTTTAGTTGGCTCTCCCGCTCGCGCTCACGCTTGGCCGCCGCCATAGCGCGTCGTCGGTCCTCGCG
GTTCTTCTCGATCTCGGCGATGGCCTGCATCGTCGGCTTGGTGCGCGGCGTCGTGGAGGGAGCCCCACGGCCGGCGCCACCGCGCGCATTACTCGCTCGC
CACGCCATCCGTCGTCGGTTAGAAAAATAATCCACCAGCGTAATTATCAGATCCACACTTCAATTTGGAATCAGAACGTCTCAGAAAAAGTGACGTTTCT
GATTCTAGTTGCATTTCAAAATTGACAATTATGGCAAGGCAGGCGACCTCGTCGACGCAGTTGGAGGCGGCGATCGACGCCGTCGCGAGCGGCGCCATGT
CGCTGCGCGAGGCCGCGCGCAAGTTTGACGTGCCCCGAACTACACTGCAGCGCCGTGTGCAGCGCCGCGCGGCGGAGGTACCCGAGTCGGAGGAGGCGTC
AGAGTCTGCGGCGGTCAAGGCGGAGCCTGTCACAGTTGATTGCAACGCCCAGAGCGACACGAGCGGCGAAGAAGCTGCAGAAAGTTATACTGAGGAGCAT
GGAAATACTGCAGAGCGTGACCAGAGTAATATTACAGGACGCAAGCGACTCGCAGAGCAAATGGAGACACCGAACCAAGGTGGGCAATTGGGTAGTAAAA
TTATATTGGTTTTAGTGGGGTTTGACCGACTTTGCGCGTGGATTTAGGCCCGCGGAAGGTCATCAATTGCAAGATTCGGATGCTGTGTACGGCGGCCGGG
AGCGCGTTGGATGAGTTGAGCAACAAGATGATCCGGGAGGGCAAGTGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCCATCCCGCAGTGCATTG
TTGATGAGCTACGGTGGGTGGAGGTTGTAATTGAATTTGGGATTTGTTGAAGCTGAGCGTGAGTTTGATTGCAGCGCTAACTCGCATCAGCGGGATTATT
TGCCTGTTGCGGGGCTGCCGGAGTTATGTGACGACATTGCTGCGTGGGGGGCGGATCGATTGCATATTGACTACTCGCGGGATGACGTCTTGGTGGGGCC
TGGAACTAAAGAGCTGCTGTTCGTCCTACAAACGGTGTATTATGGAGACCTACTGCTGCCCAACCCGAGTTGTACGAGTTACGCCCCGCAAGCAGCTATT
GCTGGGAGGTGGGTACTTGAATTGTATGGAGTTTGCGCGTACAGTTAGTGAGGCGCAGTCTAACCTAACTCTGCGTAAAGAAACATGATGTGGCTGCCAA
CTCATGCAGAAGATCACTTCGTGCTGCGTCCAGAAGTGCTTGAAGCGCACTGCTCGAAGGATCCAGGTACGTGCAGCTACAGTTAGCTTACATCATAGAG
CAATCGGAGTTTGCTGACACGGGATTATTATGTAAACCGTCAGACGCCCCGCGGATTCTCATTTTGAACAGCCCGTCAAACCCAACAGGGTGCGCTTACC
AGGCCGACGAGGTTCGTGGTTCTGCCAAGATTTCAGTAGAGCGACGATAATACCCACCTGACGTTGCTTCGTATGTTGTGTTCATTGATCATCGCTGACC
AGCTGGAGGCACTAGCAAAAGTCGCTAGGAAGTACCGGATTCTCGTTGTATCTGACGAAATCTACTCGGAGCTGCATCATTCCGGCACACATCTGTCGCT
CTCCAAGTACTACCCGGAAGGAACCATCGTTTCAGGAGGATTGAGCAAATGGTGCGGTGCTGGAGGTTGGCGCATGGGCTTCTGGTTGTTTCCGCCAAGT
ATGGGCTGGTTGCGCAGCAGCATGCTCGTCATGGCGTCCGAGACGTACACGTCAGTTGCATCGCCTATCCAACACGCTGCTCGACGGGCGTTCGTTCTTG
AGTAGGCAGCACGATCCAACATCCTCGCGAGAAAGCGACGCCAGACCCCGATTCTAACATGTTGCCTTGTTCTGCGCTGTAGTTGCGTTGAGCTGGCATC
GTACAAACGCAAGTGCCAGAAGACGCTGCAGCTCATCGGCCGCTGGTTCTCGTACCAGCTGCAGAAGATGGACGTCGAAGTGCAGGTCCCGGAGGCGGGC
TTTTATCTGTTCCCATGCTTCCGCCGACACCGCAAGGCGCTCGCGCTGAGAGGCATCTCGACTGACGAGCAGCTGTGCGCGCAGTTGCTGCAGGATACGG
GCGTGGCCATCTTGCCGGGCTCGGCCTTCGGGCGTGCGTCGGAGGAGCTCTTCGCACGACTGGCGTTCGTGGACTTCAAGGGCGACCTCGCGCTCTATCT
CATAGAGAGCATGGTAAGCAATTCCTTCAATGTGAGCCTTTGCCACCGAAAACTCGACTCACTCACCCCTAACGATATTTTGTGCAGCAAGATGACCCGT
CTTTGGAGGCCATCGAGGGCTTCATTCAGTCGGTCTGCCCCAATCTCGATATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCTTGCGCGGCCGTCTGC
CGCGCCAGCAACGGCCAGCGCCTCAGGCGTCGCCTTCTAACGAGCGAGCAGGTCGTGGGGAAACCGGTGTGCGCTCAATCGGTCGCCAACTGCTGCTCGC
CGAGGCTGGAATTTTGTCTGGAGGTTTGCACGTGAATGGCGCAATGGAGACTCTTGCCAACTCGCCGCTGACGTCACACGAAACCGCGCCCTGTGACGTG
CTGTTTCTTGTCAAACGAGAAGGCATCTTATTCGCAGCATTGCATTGAACCGCTGTCCACGGAAGCCCAGCTGCAGTCGACGGAAGCTCCGCTGAATTGA
AATGAGTTGGTGCCAGTGATGCCACTTTGAGCTTCTGCTCCGGGGCCAGGGCTGGCCACTTCTACATGGCACTGCGCAGCCGATTTGTGGCGAGAAAGTA
GCGCTGCCCGTCCGACCCAACATGGAAGGCCAACACCAACAAAGCCAAGTCCATTCGACCCACCCTGGACGGCCAACACCACCAACAAATCCAAGTCGGA
GCCATCCACAGGTCCGTGGTGGTTTCGTCCGATCGATTGATTACAGTAGTTCTCGTAAATTACACATACATAGCCTGCAACCCAAGCCTCGGTACAAAGC
CACGAAGAGACGACTGGGGGAAGTTGTCTCGGCATTTCACTTGCTGACTTCTCTCGCCTTCTCGATGCCTGCGGTCGACGAGTACCCGCGCCGTACGCCG
CCCCGGGACGCCGCGGCGCGCTCGCGCTCGGCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGTTCCAGCACCAGGTGCAAGTGAGCGGCAGCAGCAACC
TGCGCGCGTCGTACCAGGAGCCGCAGCCTTCCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAGCGCGCAGATGCGTCACTCGCTCACGCACGTGCAGGG
CTCAGACGCGCAGCGCTCCAGCGCGTCGTCCACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGTGGCTCCAACTACCTCAATCTGCACACTACAGGTCGA
GAGTTGAGCCCCCGCCAGCAGCTGCACCCGGAGTACCCGGCCGCGCCCCCCGCGGGCGATGACGTTCTCAAAGTAGAGATCCCGCGGTGGAAGTCGAAGC
TCACGACGGACAGGGCCGACAGACTGCACATCCCAGCAGGAGCCGACAGTGCAGGCAACTCGCCCGTGGCCAGCGGAGCAGGCAGATCTTCGACGTGGAA
CGGCAAGGACGGACGAGGCGGACACGGGGGCTCCATGGGGGCGCTGGTGCTCGGACGGGACCGAGATAACGGATCCAAGAAGCGCTATACGGTCTTCCAG
GTGTACGTGCACTTCCAGTCGGGAGCTGTCCGCGTGTCTGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACGCTGAGGCGGAAATACGCAACGG
TCGGGAAACTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTGTCGCTGCGTGTGATTGAGCAGCGCCGGGAAGCGATTGAGACGTACATGAACGCGGT
ACTGACCCTGCGACCACGGCCGATTGAGGTCGTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTGGACGACGAAGAAGAGGATGGCAACAGTACGGACGGA
CAGGCGCGCGGCGTGGATATGGTGACAGCTCCGAAGCACGTGCAGTCCACGTCCACAGCTCTTGGGACGTCTTCGCGGCTCAGCGCCAGCAACAGTTTTG
CCTCGGAGGACGCAGGGAATCATTCCGTGACGATGCAAGACTTTGAGATCCTGAAAATGCTCGGAAAGGGGTCGTTTGGAAAGGTCTACATGGCTCGGGA
GCGCGGAGGAGACGGTAAGATCTACGCGATGAAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGCAACCAGGTGGGGCACACGATGATGGAGCGCCGCATC
ATGAGCTCCATCGACCATCCTTTCATTGTCGGGCTCAAGTACTCGTTCCAGACCGCCAGCAAGCTCGTGATGGTCTCGGACTATTGCTGCGGAGGCGAGA
TCTTCTTCCACCTGAAGAAGTTTCGCTCCTTCTCGGAAGCTATGGTGCGCTTTTACGCCGCGGAGTTGGTGGCCGCCATTGGCCACCTGCACGAGCGTGA
CATCATCTACCGCGACCTCAAGCCCGAGAACATTCTTCTTGACGAGACAGGCCATGTGCGACTTACCGACTTTGGCCTCTCCAAAACAGACTGCACGGAC
TTCACAGGCGCCAAGACGTTTTGCGGCACCCCCGAGTACCTGGCACCCGAAATGCTCATTAGCCGCAAGAAGAAGACGGAGTACGGCAAAGCCATCGACT
GGTGGAGCCTTGGGACCCTCATGTACGAGATGCTCACGGGCTGGCCGCCTTTCTTTGATCGCAATATCGAGCAGATGTGCACCAAGATCATGAAGTCACC
GCTCAAGTTCCCGGCTCACTTCGGTCTGAGCTCTGAAGTCAAAAGCCTCATTTCGGCACTGCTGGAGCGCGATCCGACGTATCGCATCGGCTCACGCCCC
GGTGCTGGCGTGGAAGACATTAAGAACCACGTGTTCTTCTCTAGCATCGACTGGAAGTTGCTAGAGCAGCGCGGCGTCAAACCCCCGTTCAAGCCGCGTG
TGCGCAGCCCGACGGACATCCAGAACTTTGACCGTGAGTTTACGAAGGAATTGCCTGATCATGGTTTCTTGCAGCAGGATAAACGACTTGCAGTGTCACC
CAAGAACGAGTTCCAGGGATTTTCCTACACTCGAACGGAGGAGCCAGCATCAATGTCACGAGAGTCAAGCAGCAAGCGAGAAAAGCGCAGGTCAGGGCGC
CGGTCGGAGCCGCGCCTTAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGCTGGACGCCGAACTACTCTTCTGGATCTTCGTAGGGGTGCCTGAT
TCTCTCTCTCTTGCGTCTTGGGATGGGCCTTGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCAGCAGATCAGCAGTATCCCGAATTCGGCCTCGT
CGGCCGTGACAGCACGGATTTCGACACTGGTTGTATCTAGAGTACGTGGAGGCCACCGCGCTCGTCGTGTCCAGTACAAGAAGGAGGCAGCAGGTGGGCA
CCAGGAGCAAGTACATGTGATGATATTCTGTTTCTAATTAAGACTTGGTACAGGTACGGAGCCGATCCGAGTGGAGTCGTTCGCTGGGAGACGTGAAGTA
CGTTGTAAGAAAATGAATGAACCTAA