Description :
From Genome Similarity Track
Location :
Scaffold_25:1778- 41401
Transcript NameFunction/comments
Phypl_g1028hypothetical protein
Phypl_g1029RING box protein
Phypl_g1030hypothetical protein PHYSODRAFT_496973
Phypl_g1031hypothetical protein PHYSODRAFT_298688
Phypl_g1032conserved hypothetical protein
Phypl_g1033hypothetical protein PHYSODRAFT_491102
Phypl_g1034hypothetical protein PHYSODRAFT_298682
Phypl_g1035hypothetical protein PHYSODRAFT_298682
Phypl_g1036hypothetical protein PHYSODRAFT_495691
Phypl_g1037hypothetical protein PHYSODRAFT_313216
Phypl_g1038hypothetical protein PHYSODRAFT_491292
Phypl_g1039hypothetical protein PHYSODRAFT_495212
Phypl_g1040conserved hypothetical protein
Phypl_g1041protein phosphatase PP2A regulatory subunit B
Phypl_g1042putative malonyl-CoA decarboxylase
Phypl_g1043conserved hypothetical protein
Phypl_g1044hypothetical protein PHYSODRAFT_354319

Sequence
39623 bases(100 bases per row)
agcagcagcatctcccTGCGGCCGCGCACCATGTTCGCCATGAAGGGCCGCGGGCGCACCGATTCCGAGGGATCCGCCTACCGCCCGCAGTGGTCCAAGG
ATGGCGAGGGCttcgtgtcgtcgtcctcgagcggCGGCCCCGCGTCCTTTAAAGACGCGGCCACAGGCGGCGGACAGGGCGACGACCACCGGggcgagcg
ccgcaagaGCAAGGTACTGCGCTACACGAAGGAGGaactgctggcgctgcatTTCACAACCGCCGAGGCGCCCACGTTCCCGCCCGACACCTCGGTGGCC
TCGGAGCACAGCCTCCCGCCCGTCACCACGCTGCCCTTCGACTACGAAGAGATCTACAAGCAGTGGTCGCTCAACCGCAATCGCGGACGCGGTCGCGGCC
GCGGCAACGCGCCGCCTGGGGGAGAGCAAGGCAGGCGTGGACACCAGGAGCGAGGAGCGCGtggcgaggaggccgagggagccaagcagcagagagacga
ccaccaccgacacAACGAGAGAGACTCCACGTGGGAGCGCGGCGTCAAGGTCACGGAGGGCGCGCGCGGAGACGACGTCTGGGACGATGTACTGGAGCCA
GGCACGGATTGCAACGAAATGGTGCGGCGATTTTGGAGCGAGGTGGTGGGGTCTAAGTGATTAGCAGGCTAACGTGGTTGCGTCTTGTGGTTTGTGTATC
GGCAGGACTTGTCAAGTAtggcggaggctgcggagAAATTCCGACGAGAGATGGATGCGATGCgagaggagctggagggaCCGAAGGCCGAACCGGTACG
ACTACAAGGCTCAGCAGGAAAATGATATACCCCGGTTACTGACTGTGTGGTGCTTAACAGGAAGAGATTAAGGGCGATTTGGATGCcttcgacaagaagc
tggaggatgctgcggctgctggacaaTTTGATGACAGTGACACCGAAGAAGGGCAATGGGATGATCCTGCCCCGGGGGAGCAGCATAATGCTAGCAGTGC
TAACGGTCCATTGGAAGATCACACGGCGAATTTGCTGGGCCGTCAGGCAAGCGGCACCCACCTATTTGATGCCCTGGAGCCGGCCGGCGGACAGCTCGTG
CTTGAAGAGAAGAGTAGTTTCTCGCTGGCGCAAATGCCGGTTGACGAAGATTTCGCTgggctgtcgtcgctgcgcttggaggtggaggacgaaTGGTTTT
ACTTGGACCCACAGGGATTGCAGCAGGGTCCGTTTAAAACGGCGGAGATGCGTGAATGGTTCGAAGCGGGCTACTTCAAGCCGCATCTTCCGATCCGTTT
CGGTCGGGAGGGCATCTTTGCGGCCTTGGCGAATCAGTTTGTCCACGGACAGATGCCTTTCGCTGCCCCGCCAACGCGTATGAGCGGCCTTGGAGGAATG
AATGTTGACCCTCGCCAGGCTGAGCAACAGCGTATGTTGGAAatgcagcgtgagcagcagcgtcaacaacaacagcaacagcaaatgatacaacttcagc
agcagcaacagcagcggatGATGCAGCTCAACCAAGAAGAGAAGATTCGCATGGAGATGCAACGCCTTGAAATCGCTCGtcaacaacagcaaacacAGTT
gtatcagcagcagcagatgctgcaacatcaacaagagcagcagcggcagcagcagcaacaacagcaacagcagcaacagcaaatgctcctgcagcagcaa
agtTCGtggcagcgcagccagcgcgaaGGTATTATGAGCGCACTCGGCATCTTTGGAGGGAACCAAGAGACCAGCCTCGCAGAAATCGACACCATCGCAT
CGGACGGCATGCAAACTCAGTTCCAGTCCGACTTCCgtgcgcagcaccagcttaACCTGCAGAACCCGCAACCCGTTGGTCAAGACTCGATGTTCCTAAA
TGATGAAGTACAGAGGCGCGACCAGGCATTTTGGCCGAATGCCACGCCAGAAATGTCTGGTCTAGACAATGCTACTAGCCCGCTTGCTGGGTTGCAGTCA
GCGCGGCCAACGAGCCCAATGGCTCCAGAATCGACTCAGCCTCCTGCGCCACAAAGCCCAGCTGCCGCCCCCGTGGCCGGTGCTTGGGGAACTAGACCGA
AGTCTCCGGAGCGTCCGTCGCCAACACTTCACGATATTCAGAACGAAGAGaaacgtcgtgctgctcacgcaGCTCGCAAAAATGAGGACAAGGCTGCTGC
ACAGCAGGAACCGCCCATGGAAGCATCTCCTATTAAAtccaccaagaaggagagTAAGGCtagcgacgagaagaagacggaccTGGGCCCATCGAAGAAG
AATGGTACGAAGGGAGAAAGTGTCAAAACTGAGACTAACGCGTGGGCTACTAGAGCGGTGTCTGCTACTGCATCGAACAACTCCAAGTCGCTCAAGGACA
TCCaacaggaagagcagcgtgaAATGCGTAACAAGATTGGTGATGGCAAGGGTGACAACACCAATCTCGCGCAGATGGGGGCTCAGTTAAAGATGATGCT
TGGGGTAGACTCGATGGCTGTAGTACCGAGCATTCCTACCTCCCCTACAGCATCGGCCCCGGCTCCGGCCCCGATAGCCAAGTCAGCGCCAacggcagca
ccaactcTGGTCCCTGCTGTGCCCGTAGCAAGTCCGTGGGGTACACCCGCCGCTGTGACGAAGACAAGCATGTCGAAGTCAATGCGTGATATTTTAGCAG
AAGAGGAGCGTCTGGCGCAGAAGCGGGCTATGGCCAGCGAGAATGCACCAACCAGCTCACACTGGATGAACGTCGTGGCAGGCAACAAGGTCGCTGCTAC
AGCAATCCCCAAGCCGTCCCGGTCAGTATTGGGTCCTGTTCCTGCGTCCGTGCTAAAGAGCCGCCAGCAGGTCCGTGCCGCCAACGGTGCTGTGAAACCA
TCGCCGCCTAAGACCGAGAGCGATGCGTCATTCTGGAACTTTGGAGCAGCCCAGTCGGCTGGCGCGGAGTCTGGGTTGAGCAGTGCTCAgacgtccagct
cgaacgcGTTTGGCTCAAACAATGTGTCATCGGAGTTTATGACGTGGGCCCTGAGGCAGCTGAAGACTATTGACAGTAACGCCAACGTGACGTTGCTGGA
ATACTGCGCGTCAGTAGAGGATCCTGGTGAGATCCGCGAGTATCTCGCGGCGTATCTGGGCTCGACACCCCGTGTGTCAGCGTTCGCCACGGAGTTCATC
CAGCGCAAGAAGACCCAACACAGCGGCAAGAAGTCGCCGGATCACCAGgacgctcagcagcgtgcgtCCGAGACGGGGTCATCGAACAAGCGTGGTAAGC
GCCGCTCCAAGGGCCAAAAGATTGATCCATCACTGCTGAACTACTCCGTCGGCAGCTAAGTGCTAACTGAGCATGCAGTGAGCAGTAGCGAGCTAGTGAG
TCAGTCGTGTGATAGGAACAGGTAGTGCAGCGAGCATAGGAATCAAACACGGATGCTGTGGTCGCTTTTAGGCCCTTCGCTTTGCCTGTGAGTAGATAGA
TCAAAGCTTATCCTCGACacaaggtggtggtgggtgCATTAGTGATTGTGCATACAGGATGCAGCTGTCGGGATCAGCGCCACCGGTCAACTTGTTGCTT
GGGTCGATGCTCTTTGTGCAAGCTGACTAAAGGACCATCCTCGACAGGCCGACGCAGTTCGCCCCAGCACGAAGCCTTGTAGTTTGTTGTCGGAAGCTCA
CAAACTGTTCACCATCTTGTTaggtgtcgctgctgtcagaTTTGTCAACTTTGCTGGTTTACCCAGGACGTGGCTTggctgtcgttgctgtcgccaACCT
GGCCTTGGGTAGGCTCGGTCGCATCTGGAATGTCGTTGCCAATTCTACTATCATTTCCACCCTTGCCACCCTGGCTAGGCTTGAGCGCTGTTCGAACGGG
AAAAAGATttgacgatggcgagcagctcattTGCGCCATGGCCGCGCACCTCGACGCGTCGAATGTTGGGAGCTGTTCGTTACGAGCATCGTTCTCCCGG
AAAGGCTCCAGTCGAGACCAGCACTCGTGCGTCTCCAATCGTACCTAGCCGAGAAATTCCACTTAGGTACGAATATCTGGCGCATTGGGGAGGAAGAACC
ATTCGACGCACAGCGGGCTACAGCTCCAACTGCAGTCGCGATGGATgaggagatgaagagcgagacgaaggcggaggtggcgccggcggtggcggcggcc
acgagcgaggagaagcgctTCGAGATCAAGAAATGGAACGCCGTGGCTCTCTGGTCCTGGGGTGCGTACGCCGCGGTGCTTGCTATCCATCGTCCAGTCC
GAATCTTGTAGCAACAGCTAATAATTACTTTCATACTGCGCAGACATCGTCGTGGACAACTGCGCCATCTGCCGCAACCACATCATGGACCTGTGCATCG
AGTGCCAGGCCAACCaggcgtcggccaccagcgAGGAGTGCACCGTGGCATGGGGCGTCTGCAGTACGTCCGACGCTGGCTTGGATCTATCTGCCTGGGC
TGATAACCTTTTGTACTAATGCTTTTTTGTGATGATATTATTATTTGCAGACCACGCCTTCCACTTCCACTGCATCTCGCGGTGGCTCAAGACCCGCCAG
GTGTGTCCGCTGGACAACCGCGAATGGGAGTTCCAGAAGTACGGCAGATAAGCAGAGTCGACGACGGGTGTGCTCAAGAGATGCAGGACGGCTGTGTATC
TACGTGCTGGCTACGGCGGTAACCGTAGAAACAACTTGTGGtgtgaagctgaaggcgctgcagtttgcTGGTTCAACCCGCATGCCAAGCACGAGAGAGA
GGGAGACGCTTCGGGGCGTGGTTTAGCTACTACTTCAGTACGTTCTTATCTCTCATTAACTTCTTTTACTAACGTTTTATCAGCGAATTCTGAATTGACG
TTCGCACCAGGCGAATCAGTTTACGGGCTATTGAATGCCGAACGATCGAAGCGTCTTGTCTTCGAGAATACATAAGTTCAAATTCTTTTACGTCCACAGG
GAGAGCACGCCCATGGCACTATAGCCGGCGAACAGAGCCGAGTACTTCTCGACCTGATACCGcgggtcctgcagctcctgcgggATGATCTCCATGATAG
CGACGAACAGGAAGGTGCCGCCAGCGAAcgcggcgcagacgccgccCGCGGGCGTCGCGTGGTTGGTGTCAACGAGCAGGCGGCCGAACAGGATGCCCGT
GGGCGTCATGAGTGAAAAGACCGCGATGGAGGACAGGAGCTGCTTCCGCGAGACGTTGTGGTGCAGGAATTCGAGTGCCAGCGCGAACGCTGCCAGCGAC
TTGTGAgccaagatggcgacgaggatATCCCAAGCCGGGCTGCTCGAGGCTCCCATCCCCATGCCTTCCATCACGGAGTGGAAAGACAGTGCGATGAACA
CGACGAGCGCCAGGATGGGGTTGCCCTTAACGATGCCGTGGATGTGCGAGTGCGGCTCCTCCTTTTCGTTGTCAGCGTGAACAGCGACCTCGGTGCCCGC
TCCCTGGGTGCCGTAGTCTCCAGTCTCCAGCTGGCCGTGCGAGTGGTCGTGGTCATTAGCCTTGGCCAGGTTGTCCACCTCAGCGGCGCGCGTGACCTCG
ttcgcgagcagcgcgtcgcgcTCTTGCTCTGTGCCATGGGCATGGCCGTGCCCATGGACCGTGCTGTagtgccgctgcagcgcgtgcgcgagcacctcga
tgagcagcaccatgagGAAGCCGCAGCCGTAGAAAAAGTTGGCCCACTTGAAGCAGCGCttgttgtcgccgtcgtagcGCGTGCGTACGGCCAAGAACAC
CTCGGCCGTGTGCTCGCAGCCCCACTCGGTGAGCGCCGCGTTGTTCTGCGCGTCCGGCAGCAGGTGCATGCACGAGCTGGCGAGGAAGATGCCAGCCGCC
ACCATGttgagcacgctgctggagcgcttGCTCACGCGCTGcctgctcagcagcggcgcAATGCCGCCCACAAGCGCCAGCCCCCAAATGAAGAGCGCCG
CGGTCAGCTTGAATTCGTCCACGGGGTCCATCGCTTGTCCAGGAGGTACAGAGTTCGCTCCAGTGATCAGTCGTCGGGTCCTTCGGTAGGAAATCGCAGA
GTGGAGAGCTGCGtgtgcagcgctgcgcttggccttTCCTCGCGTGGGTCTGGTGGCATTCTGAACGCGCACATCGCGGCCATTTTCCGCCTTATCCGAC
GGCGGACCAAGGTGCTTGGCTTGGATACAGAATCCGCCCTACAATCACTCTATACCCTTTTAAATACAGTTATTTATAGCATCATCTTAGAAAGGGTTTT
GGCATTGGAGACCCCGGTTAGTACTGCAGCATCACATTTATTGTGCACATGTAATACCCTACATCTGGGTCAGTTTGTGGGAGGAGTCTGTAGAGAGACT
TGTCCGAAGGCGGCAACTTTCAGAGTCCGGCCAAGCAACGACATGGGAGCACAAGGTAGGAGCGCTTGCCTGTTTAATGCTAACGTGGGCGCGTATACAC
GCAGTCTTCAAGCTGCACATGTATTGATGATGTGTTGCTGCATCAGCGTCGCGCAGCCGGCCGAGGCACGCCTTGGCAGTGCAAGATACGGGCCCGTACT
CGCTGTCCGTGGACAAGATCAAGGTggtcgtgctgggcgaggcggccgcgggcaagacgacgctgttCAGGCGCTGGATGGGGGCTCCGCTCGATGCCGA
GTACGCGCCGTCTGCCTCGGGTGAGCAAGCAGAGGCGGCCCTGTGCAACCCAACTGCCTGGTGCGTATCCGGTATTATTGAGGTTATTAACCGCAACTTG
TCGGTGGCGCATTGCGGCGTAGCGAGCGTAggcgccaagctgcttcGACTGGAGGGACACGAGCCAGTTGTTTTCGAAGTGCGTCGTTGAAATGCTTGCG
GCGATCTCTTGACTTGGGTTGACGAACTCGTGCTCGCAGCTCTGGGACGTGCCGCCGCAGAGCTTCGCCGGGCCGAGCATCTTCGCGCGCTATTTTCGCG
GCGCCCaggccgtggtgctggtcttCAGCCTGCAgacgccagcgtcgtggcgggTGTTGCCCACGTACCTCGACGTCGCCCGTCGAGAAATCGCCGCGGC
CGAAACCATCGAGACCCAAGCACCAAAGTCGCTGCCGGTTGTGATGGTCGGCAACAAGAGCGACTGCATAGGTCAAGATGCCCAACacgagcgagaagct
gctcggtcGTGGTGCAATGAGCACGGAGTAGCCTACGTCGAAGTGTCGGCGCTTGCTGGCGAATCGGCCGCAGTGCTCGACGTCCTCAAGCTGTTGTAGA
CTTATAAGACCTATCTAAATGACCAATAAAAATTGGTAGATTCCTACAATATCGACCTGATTGGGCACAGAAAGTGATCCTTATGATgactacagtacat
gtagtaggTCGATACAGTACCATTTCCCGCCACCCAAAGATGTCGGGCGAGCAGGCGCGCACCAGCATGGAGCCCCCTAGcctggagctcaagcagctgg
GCCGCGAGACCAAGAGcctcaagcacaagcacaagagCAAGCGCGGCAGCAAAGGCAGCGCCGCTGCGAACgccacggagctcaagcggtcgccgtcgtc
cgcgGCGTCCCCCGGTCGCCACCACGTGCACTCCAAGCGCAACGCCAAGGCCAACcgcgaggacgcgctgcgggagctgctggcggggAAGATCGCGGAG
ATCGAAGTGGGCGGCGACCAGAACCTCGAGGCGCCCATCGACCTGTCGGGCATCTAccaggacgaggcgctgccgacgcagctgaaggacaaggcgGAGG
CCCTGAAGGAGGGTGCGGACATGcccgccgaggagaaggtggcggagctcgtcagcagcatcgcccAGGCGGTACGAATATAACAAGAGAGAGGTGGTGA
TGCTGGACTCACGGACGGATGTATGAcagagcgagcagctggGGCtcatgcagaagaagatcggcGAGCTGAACGCCAAGTGCAttctgctcaagcagcg
caagagcgCAGGTGTGTGATGCGCTTCTGCAGTGGGTGGTACTTGTTTTCTGATGTATGTGTTGTGCTGGGTGCAGTGAGTACGGAGCTGGGCAAGACCA
ACACCACAAAagccaagctggagcagctctgtcgcgagctgcagaaACAGAACAAGCTCATTGTTGTGCGTGGGGTTTTGAAGCATTACGGGTGCACTTT
TGAGTCTATGTTGACATTTGACATTTTGGTGGAATtttgttggtgttgttgttTGTCTACGTGCAGAGCGAGAGCCGTCGTatcgccgacgaggaggatc
AGAAGAGGTACGCACGCTTCAAGTATACAAGTTGGCTGGCAGTATCTCACTGCTGTTTCATGATTGTACAACTTGATTGCTGGTTACAGACGCGAACTGT
CAGCTCAATTTCAGATGACGATCGAAGAAGTGAGTGCCAAAATGGACAAGCAGGGTCAGGACTACGTGGCCTCGTTGAAAGAGAACGAAAAGTACGTTTG
TGAACCAGCTCGTTGCCAGGAAGCCGTACGTGCGCCCCAATACTCATTTTCTGCCTTCATTGAATTTACAGCCTTCAGCAAAAACTGAAGACATTTCTGG
AGCAATACACGACACGGGAAGAGCATTTCCAGCGGCAACTAGAGGCCAAGGATCTGACTGTCCAGCTTGCGGAAACGAAGCTACAACACCAGGTAGAGCT
CACCACGCGCGAGGcggagaaggtgaagatcACTCTTGACAAGGCGAAGGAGTTTTCGGACcgcgaggtgcagctgcaaTCGCAGCTCAACTCCTACTCT
GAGAAATTCGATGTGGTGCAAGAAACGCTGACGAAAAGCAATCAGATGTTCACCACGTTCCGTGAAGAGATGGACAAGATGGCAAAAACAACCAAGAAGC
TAGAGAAGGAGAACCTTGCGCTCAGAAAGAAGTGTGCCCAGTACGACAGCGGTGCGATCGCTTCTATTCAAGAGAAGGTATCATCTGCTGAGGAGACGCT
GAAGCTCCAAGAGAAGGTCAAGAAGCTAGAGAGTCTGTGTCGCCACCTCCAAGCCGAGCGCAATAGCTTTCGACAAGCCCAGCAAGTTCAAAccgctgcc
gttgctgccacCGATTCGGCTTGAGCTGTGAAGAGCGTAGCTTCAAGCGCACACTCACCAAACCAAATATAGCGTATCCATCCAAGACTTGTCGACGGTA
ATAGATCCCTACATGCCTGCGTGGTCTATATTTTCGACGATACTGCTGCTTGTTATGCCCAATTTTTCCTCTGTGGGCAAGCGGGGGCAAGTTCGGTAAG
CGAAAGGAGCGCAGTGACAATGAAGTCTGGATTGAGCAACGGGAGCAATCCGGGTAGCTCTTCGTTTACGGGGACAAGCCCATCGAATGCTCCAGCGACT
TTCATGCATGCGAAGAAGCGCATTGGTGGCAAGGATGCACCGGTCAGCTATTCCTTTGAGGAGCGAGTCTTCTGTCCAGGTGATACAGCGCCCGATAAGG
CGGCAGCGAAGTTGGAGGTCGTGGAAATGCTTCGTTCGCGCATCCTTTCATCGGAGACGCCGCAATGGGATCAATCAACCTCGAACTGGGACAACATGCA
AATGACTGGCAAGTGCTACAAGCGAACCAACATCAACGCTGAGGTACCGTgctcttttttttttactgaAGAACGACCTGCCCGTGATGCCAATCTCTTG
TGTATTTGATGAATGCATCGACAGCGAAGTCGTGCACACATGTTCGCGTACAACTACCGtgccgagaagctgccgaagAAAAACCCGACACTCAAACCGA
ATTCGAACCGCTTCAACACAGGGATCCTGGAAGTGGCTCTGAAGGACGAGTATGTGGGCGAAGCCTTCGGGGACGACCGTGTGATGAAAGTGCGTTTGCC
ACTTGTTGCAAATCCGTCGGCTTGCAACGTGGTGTTGATGTATTTCATTGTGTGTACAGGGAATCGCAAAGTGCACGGAGGAACTGCCCAACCATCCAGA
CCTTCGCGATGCCAAGCCTTGGAACCAGTCGGTCGAGCTGACAACGAATGCTCGCAAGGAGCACGTACGTGGTGAACCTGCTTCTAGTGTGATGCAGGAC
CCAATTAATAGCGTCCTTAACTAATCCGGTTGCGTTGGACAGTTTGTAGCATTGGAGGCAGCGCGACACACCAACAGCGATAAGTGGCGACACAAGGTTG
GCGCTAAGGACAACTACAAGAGTCCGGAACAGCTATCGAAAGAGTTGTCGGAGCGCAAACgccaggagaagcaggagctcaTAGCTGCAAAGTCTAGCCA
GCGTCACTAGGGGGGTAAAAGGCAGAAAACTAATGAAGATGAGGCCCATTTTGGAGTCTTGCGGTAGTGAACGGACGCGGCGGTTGCTAGCCGACGCAGT
GCCCTGAGAGCACTAAAGCATTGTACAACCAAGATGTCGACGCCGACTCCTCCTGAATCGCTTGTGCAATACGGCGAGCCAATCTTCACGGGTGAGACGC
TCGACCCACCGAAGAAGGGCCCGGGAGTTGCCAACTCAGGGTCTTCCTCGAACTCAGTCACCGCAGCCGCCGtcgtagcagcagcagcggaatCGGCTGG
ATCAGCAGCCAGCGGCAAAGGCTCCGACGGTGTTGCACGGGTCGAAGACATCCTAAATGGTGTCTTACCACCTCAGTACGCTGCCACCTCAACTCAATGG
TAATTGATACTGAAGTATGTGCTAACCGAACGTGTCTGCAGGATGTGGTCCGAGGAAAACTCGGGTTTCTGGCTTCGGTACGCGTCGAGCGTGCCCTCGA
CTCGCTTCGACGTGCTAAAGTTGCAGGAAGCTCTTGATGCCAAGCTAGTCCACCGACAGGCTCGTGAAAGCGGCATTTGCCCTGTTCGAGAGGATCTGTA
CTCGCAAGCTTTCGATGAGCTGATTCGAGAAGTGACGCTCAACTGTCCCGAGAGgggcttgctgcttctgcgagtCCGCGATGAGCTTCGACTCACGACG
GATGCGTACAAGACGCTCTATGACTCGAGTCTGACCTTCGGTGTACGGAAACAACTGCAGGCTGAAGATGGCATGGGCGGCTTGGCCGAGCAGATCGCCA
GCCTTCAGCGGGACAAGGAGGAGAGTGGGAGTAAAGTGGCTGAGCTCACCAACAAGCTCGAGGTGATTGAGAAGCGCGCAGCCGAACGCAAGGCGCTACA
GGAGAAGAAAttcaaggaggagctcgacttCCTCAAGTACCAAGGACAACATCTCGACGCGTTCCTCAAGTCTGCAGGAGGTGGCACCACTGGTGTTTCT
GCAGGTGCCATCAAGTAAGCAGGAGATGTTAAGGGCCACCAAGCAGTGTAGACGCAAGATACTTCTACATGAGATGCTCACAACTTTGGAAACAAAAGCT
CGATATTGAGAACCCACCCACCGTTGCTACATGTTGTTAGCACGTTGGCCGGCGTCTTGATAAACCTTGTACTAGCTTACACTCGCAGATGGCATCATTC
TTATGTTGCATCTTCCGCTCCGCTGCTACTTGGATCTGGCTGTGGCTGACTCATGCCAGCAGCCATTTCAGTGAGAAGCGTGTGCGCTGCCGTCACATAT
TTCATCTGCTCCTGCGTGACTTGGCGGCGTACGTGCTGCCGTTGGACATGTGGCAACAAGAAACTTGCTACAAGTTCGCGCACTATGGTTTCGTCGCTGT
CCATTTCAttttcaagctgcagcacgataCCGTCCACACCGGCGCTGCGTAcatgcagctcgtgcagtgcTTGGGCATGCGCTTGCTCGAGCGCAACCTC
TTCCAGCACAtcgtccacgaagtcgcGAGATGTTTCCTGGTGCACCTGCATCACGCGTCGGAAGACCTCATCCTCACGCTCACGCAACAAATCTTCGGct
tgtcgccgtcctccCTCCTCTACTTCGCGCACGCGCCGCTGTTCAGCAGCCTTAACCACGAACGAGCGCATCTTAGCCACCTCACGTGATCGAGAGAGCT
CTTTGGACAAGAAGTCGAGCATCTCCGAGACCACTTCACCCTCCACGCGTGTCTTCGCTGCAAATGCAACGCGATCAATCGCTTCGGTACCAGATCCCTG
CAGGAGTTCGAATtcatgacgacgctgcacTGCAAGCTGTTCGTCGGCAGCGCGTAGCTCGGCAATAAGCTCAGCTCGTCTCTCCTTGCCCTCGAACATC
ATGTTTTGAACAGCACGACCACGTAGCAATTTCTGCAGTAAGCGCACTGCGTCCTCcccatcgtgctgctgtgtgtCAGCGATGTGTGCAAGCGTGTAGT
CGGGGGTGGGTGGGCGTACGAGTGGTTGCTGTCTCTGACTTGCTCGTCGTGAAAGTGGGCTGTCAACACTCTGGTGAGACTGACCATGCGCTCCAGGAGT
TGCATCTCCGGCATTTTCGCTCTGCTCCTTACTTTTCTTGATAATGGACTCCATCTTGAGGAGGTGAGCTTCTACAGCCGCCTGCTTCCTCTCCTTGGCA
GTGCGGCCGCTCTTCTCACGAGGCTTGTATTTTCCCGCAGCAGGTAGCAACATCCGTGCTGGTAAAGCACTCTCGAGTTCGCGCAAAGCATCAAGCTGTA
GGAACTGAGGCTTGCCGATACCCAATTCACGAACCTCCATCTTGCCAGCTTTCCCATCACGTGTGATAGGAGCATACACTTGCGAGCCGAAGTTGGCGTA
TTCGGCAATGATGTCACGCCCCCGCTCAGGCTTTGATGCCCCAAAAccgcgctcgtgctgtctCTGAGCTCGTTTCTTGGTCAGTTTCCGTAGTGCTGCC
ACGCGCTCCTGTTGAATAGCCTCCAGCGCATTTTCCTTTTCGTGAagcagacgctgacgaagcGCCTCAAGCCGCTGCTCCGAAAGAAAcgcgttctcct
tctcaCGTTCTGCAAGTGCTTGTTCGAGCAGAGCTACCCGTTGGTCATGGAAAGCGTCGATCTCAGCTTCGCGGTACGCCCACTCTCGGGTCTCCTGGGC
TTCCAGCATGACCTTacgcagcaggaagctgGCTTCGTCGGTCATGGGCGGCAATGACGCCTCGAACGCACGCTTCTTGCGGTTGCGCTCGATGAGTTCC
AGCTCAGCCTGACCGACCGGAAGCTGTCCACGAGCATGGCTTAACCCCGCGAGCGTTGCTATCTCGGGTGTTACACCGGCGGCGGTCTTTTGGACGGTGT
AGTCGGGTGTGTATGGATCTGTCTGGGCGTCCGAGTCGCGATAAACCGTTTGGATGCCCACcgaccgcgtgctgcctTCGACCATTTCGGCAGCAACGTa
ggaagacgtcgacgccttcgGATCTCGACGCTTGACGTGCGTTGTTGGGACAGCAGCATACACAGGAGCTAGGAAAACTTCCGGTGGCTCCGCTTCCAGA
TGCGGCAACACTGGTCTTCGATGAAACTTGACACGTTGACTACCGCTGACGAGCTGACTGCCCTCCGTTGGGTTCTGGTTGTTGATCGTGCTGCTTGTAC
TTGCAGCTTTTGAAGATGCTCGGTACACTCCTTTGCGGAACGAACCGCCAGAACTCGAGACCGTGTACACCGCATCTACAGCAAACAAAGCACCTCAGGT
TAGCTGCAAGCACGAAAGACCCATGGCGACGACAAGGAACCCACCATAGACAGGATCCAGTGCCCGGGACGGCACCGTCCGCGACATATTGGCGGAGCCT
CGTGCCGACAGCTCTGAAAGATCGACCGGTCGCAAACGAGGGCTGTACACGCTGAACCGTTTCGGAGACGCTGTGGCAGGAGGCAGCGGAAATAGCACTT
CGCGAGCAACACTAGCGGCAGCAACATGTCCATTTTCACCGATACCTCTGCGCACACTACGAACACACTCTTGAGACACCAAAATGTGCACGTGCACTAA
CCTGCTTCGCTGTTCTAAGACGACACGCTCTTGGCGAActtgagcgcgagctgcttggagtGAGTCACGCAGTCCGCCAGGCCGATGCCGTAGAAGCTGT
TACCACCCAGGAACAGACCCGGCGCGCTGCGAGCAACCTGCTTCTCAAtacgctgcagcgtctgaCCGAAGCCCACATGGTACTGCGGGATTCCGTTCGT
CATCGCCATAGCACGCACGTAGTCGGGCTTGCGTGTGATGCCGAGGTGTCGCTTCAAGGCGTCCAGGGCAttgcgctccagctctcCTTCAGGCAGTGAG
GCCACTTCACGGAAGTGCGCACCTCCGCTCATGACGCTCAAACGCGTCTGCATTTTGCCCTCGGCGTTCTGCACGGGGAACGTGTTGGAGTCAAATACGA
CACCAAGCACCTTTTCGCGCTCGGCAGTAGGGATCAAGTACCCGAAGCCGTCGGTAGTCAGCACCTTGTCGTTGTATCCGACGTGCACCATGCCCATGTC
CACGAacttgatctcgtccagagCCTCAGCCAAGCCAGGCGCTGAATCCTTCACGGCCGGAGCCAGGTAGCAAGCTGGGATAGTAGAGAACACATGCGAG
GCCTTAATCGGCTCCCGGATCTCTCCGGACTTGGGGTCCTTGCTCTCCACGACGAAGCTCGGGCccttcgacgacgagttcttgtGTCCGTGAACTCCCA
GCCTCGTCACCTTTGtgttcagctgcagctccgccatcGGGTCGTCCTTGATGCTGTCTGCCAGTGCATCCATCAGCGTGCTCATGCCGTCGGCGAAGCT
GACACTGACGGACTTCTCGTGCTTCTTGACAAAGTCCGACTTGTtggtgccgtccagcagcgtgccgtcTCCGCTGGAGCCGCCGAAGAGCATCCCCATG
ACCACGGAGCCGTGCTTCCTctccaggtccagcagcatggggAAGCACGAGCGCACTGAGAGCTTCCGGATGTCTCCGCCGAAGATGCCCGAGCACATGG
GGTCCAGCAGCCTCTCGGCCACCAGGGGGCTGAACCTCCTGGCCGTGAACTTGTACACCgactcgtcctccaccgccCCGGGCTTGGcgaacagctcgtg
cagcgccgcgcgcgccacggccagcgacagcggccagcgcagcgcctccagcagcgacgcgggcagcttctccacctggCCGTCGCGCAGGATGTAGCGC
GCGTGGGCCGCCGGATCCACGGCCTGCATctggctctgcagctgcagctgctccacgaggCGCAGCATCTCGGCGCCGTTGCGCGACGGTCGGAAGCCTC
GGGGCCCCTCCTCGAACAGGAAGCcctcgcgcttggccgtGCGCACCCAGCCGcccgagacggcgctggcgtccagcacgcggacgcgcgtggcgtcggc
cgcggCCTTGGGCAGGGCCTGGCGCAGGAAGTAGGCGAGGGTCAGGCCGGagatgccgccgcccagcaccaccacgtcgcgaGCTGCCATCGTTGTCACG
CGAGATGGGAACTGTGTGTTGTTATTAGAAACGCAGATAGAAATGCAGCGGATACTGCCGATTGGTTAGAAAATGCAGTTTGTTATTGACCAATTATatc
cacgttgaagtggttgaaGTGAGTGCCCTCCCTTGGTCGTGTACTTTAGTTTAGGTGGGCGACTGcaccttcttgctcttgAAGAGCCCGCCGAGCGCGC
TGAGGCCGCCCGCCGGCCTGGTGCCCTCGCCGTTGGGCGCGAGGCCCTCGCTCTCCgacttctgctgcttggcgcggcgctccagctcctgcagccgcGC
CTCCAGCTGGTCGTACGTGCCCCTGGCcacgccgcgcagccgcTTCTGCAGGATGATGGCCGAGACGatgagcggcagcaggaacaggcTTAAGAAGAGC
GCGCACAGCGAGAtggccagcgtcgtgccCAGCACGTTGTTGCAGAGCGACTCGTTGATGGCGTCGAAGGACAGGTTGGCCCACGCGCAGTCgcccgagc
agcgcgccTGCTCCACCGCCGTCATCAGGTTGCGCACGGCGCCCTTGTCGCCCAGCATCGTCGACAGCGGACCCGTCTTCAGCGCCGTGATCTTGGTGAA
GTAGTTGGTGGCGAACTCGCTGATGGACACGGAGTGGTTCCACGCGTCCGGGAAGGTTTTGCCCGTGTCGCCCAGAAGAGTCTCgcgcatctcgtccagc
atggtGCTCGCCTTGTCGTAGGCCACCAAGTACTCGTACGCGCTGTTAAAAGCGATCTCGCAAGCAGCTTCCGGGATGCTACCGGCGTTCTTGGAGTTGC
ACACACCTTTCATGTAGCACACAGGCAGCTCTTCCGTGGTCGAGTTGGTGCAGCCGTACGACGTTGACGACTCGCTGTATGCCAGCCACGGGGTCAGCAC
ATTTTCAGTCGTGAACTTCACAGTCGGTGGTCGCTGCACGGCCGTGGCTGCCGTTGTCAATTTGGACACGAGgctcctcgccttcgtcgagttGAAGTTA
AAGTCGGTGAGGTCGTAGTTCGAGACGATTTCACCGTAGCTCGCGACTATCGTCTGCAAGTGCGTCGTGTCCGCTCCCTGCAGAACCTTGTATTCGTCTT
CTACGTTGCACGAGAAGGAGAGCGGGGCGTCGAGTCCCAGTGGTGTTAGGACGTTGCTGCCGTTGAAGCAGGCATTCGCCATAGCGGCCATCTGCGTCGA
TGCGTACGGGGACATATCCTGGTGCAACAGCTTCATGTATTCGCACGAGTCGTACCACACAGCTCCGACGGCGAGAAGGGATGCCGACAAGACGAAGCTC
AGCACACACACcagcacgcccagcgacCAGCtcacgtgcagcaggtgcacccACTGGGTCGTCTTGGTAGTGCATGCGTTCTTAACGATGGCAATGATGC
CCACAATCGACGCGATGATTCCGAATAGGAAGACGCAGACCACAAGAGCGCTGCGGGAGAAGGACAAGTCGTTGAAAGTGCTGGTGAGCACGTCCACAAC
ATCCATGGAGCTGTTAGTCGCTGCACCCAAGGCAGTCATATCCCGTACTGCCGTGCGCAAAGTCGAGTTGAGAGCGCTGCCGCCAGTCACCaacgagctc
tgcagcaagCTGACCGCTTCTCCGACCACCTCGCTGCTagcggagatggaggcggcaGTGTTGTTGACAAAGAACGTGACGGGAGAGCCGCAAACTCTGT
CGGGGCATGCCAAGCAGAACGATTCACTTGTCTCGGGATTGCAAGTCAATGTCGGGAATGCTCCGTGGTTGTAGTAGATGCTGCCGAAGTCCGCAATCAT
CGACCTCAGCGTagcgccgtcagcagcgaTCCAGTCCGAGTTCTTGAGCTGAGCGTTCACTGCTTTCGATGCAACAGTGAGCTCCGTGGTGGCGTTGTTC
AGCGGGGTGAGCAGGTTAGCCACGAAGATATTCGCGTTCTCTAAAGTTGCCTTCAGCGAGTACAGCACGTCTTCAACACCGTCCGAGATGTTGGTGTTCA
GCGCCGCAGTGATCACCATGCAGATGAAGACTGCCAGCGAACACACGAGGAACGTGAGGGTGGGAACGATGATATCGCAGCGCGAATAGCCTTTTTCGTT
CGGCTCGCGGCCACCACATCGGTTGAACACGCATCGCAGCACCACGAACCCAATGCAGCCCAAGGCCGTGAGAACTCCCATCACAGTGCCGGGAGCCACG
AATggcgccagcgagctggGGTAGCCCGTAGACATCCACTTGGTCGCAGTGGCAACATTCGCGTCGGTGAAAAGCTGGCGGCGGGCTGCCGTTCCGCCGG
GCACGACGTCGTCCCACTTGCAGTTGCTCCTGCGCTCGCACTTCCCCTTGCTGTTGCACGAGTCGGTGTCGAGCATCACGACACACTTGCCAGTGATGTC
GCGCACGGCGTCAGTGCTTGCGGAGTCCACGCAGCGCTCCAGTTCTGCTGCCGATGAGGACTTGACGCAGATGTAGGTGGTGAAGCTCGCCAACGATTCC
TTGTACcagctctcgctcttctcgcgCATGCCAGACATGGCCGTATTGCCCGCAACGGCGCTCAACTTGAGCGCACTCTGACGTGCCGTTTTGTAGGCCA
CAGCGGCGTTGTTCTCGTCGGCGTTGATCTCCGCGGACGTCATTCCCGTTGGCGACACGTAGTTGGTGTTATCCGCCGTGCGCGCCGGGCAAGTGGCCTG
CCACACCAGAtccgccgcgctcgagcacGTCGATGGCCACGTGGTTGTTGTCCCAAGCACCGGGCTCCACCCCATCGTCGTGCTCAGGAGCAACGCGAGT
CCCTCCCGATAGCGCATGGTGCCAGTCGCTTGGTTTCGgtctcttcttcctcgcgcCCTTGCTCAAGCCGAATCGGgaatgagctgctgcggcagccaAA
ACGGACGAGCCCGACAAGATGCAGCACCCGAGATAGACCATAGTGTTGGAGGTTTCCACGTGGGAGGTGGCGAGCCATGCCACGTAAATATAGTTGTGTG
CAACATCGCAGATACATCGGCAATGAGGTGGCATGGCTTATTTCGGATATTCTCAGTTCATCCAAGATTATCTGCCGTGGGCACCAAAATGAAAGCACAA
CTCGTTGGTGACCGGGTGCCACCAGCCTGGTCCTTCGGAATCTTTCATAATTTATTTCATTCTGGTGGCCAGGATGCATTGAAGCCTAGCAAAGGCACAG
GATGGCGAAAGCGACGACGGCTCGAGCTCCTATCCATCTTGTgcgtgcttcttggcctgaGCTCGATCCGTGGTCACCGTGCAGCTCTCGTCGTTCTTGA
ACGTTGAACCTTCTCACTTGCCGAGCACGGCTTTGCTTAAAGTTGAACGAACCCTCGACGATCACAAATCGAGGAGCTTTGGATGATCCATTGCAAAGTC
CTTGGCAACGTAAACCGCCATGTTACTCTCCAACAGACGttcaacttcagcagccGCGACCTCCATGCAGTAGAAGGCGGAGATGAACCTCGTGTGTTCC
GTCCTCTCAATGAtctggagcaggaggctcAGCAACAGGACGCCATGTGCCTCTGATGGGTGCGTTGTGTACTGGTAGCATCAGCTACATCATGACCCCG
TCGTGGCATCGCAGACTTCCCAGAACAGACCCACTAGCTCGGGGATACTCAAGCGATCGTGGCCGCATGTCTGCCGAAGTGCAGACGGAACTTTGAAAGT
CTTGTGGCTGTCCATTGTGTTCTGTAATGATGGCGCTCGCGTAAAGCAGTGCGATGGGGAGCCGCGCGATCAAATCGCTACATCCGACTAAGTACGCGGC
CGCATCTTCCAAAAAGGATTAAAGGGATACAACACCCCAAGGGGCTCCACCGACGCCAGTGGGGGAGGCGGGAGCAGGAGCCATGCCGGAGCAGCAtagc
aacaagaagaagaagaaccgCCACGTATCCAAGCCTGCCGCGGTGCGCGAGACGTCGGCGCCTGCGTCCGCCGCGTCCGGCGTcggctcctccagcgcca
cgagcagccaCCGCCGCGACCTACTGGACGGCTCCATCCAGGAGGTCTCGCGCCAGACACTCATGGAGAGATTCCGCAAGCGCGGCCGCGTGGAGAGCGC
CAACTACGAGCAGCGGCCGCATGCGGAGCGCGACCgggcggcggccagcacgacgctgcagtccaACAGCTCGTCCTTCGCCAACACAGCGGACAGCGCC
GCCCCCCTCGTGCTGCGGGCGGGGCGAGCACCGCACCATGCGACATTCCTGGTGCATAACAATATGCTGGCGAGGCCGCAGTCGGCGCCCAATCTCGCGG
AGCAGGTGCAGAGGATGCAGAGGCTGTTCGTTAGGCGAGTGCGAGTGACTGACGCTGTGTTTATTGCAATGATTTGCTTTATTTTAGGCTGACGACGAGG
TCATCGCTCGTATCTTTCCGGATATTTGTCCCCGTGAGCTGCGGATTGCAGAGGTGAAATCGTGGGCGTGTCCGTGGATGGAGAAAGAGTTCCCGATCTC
TCCGGAGCCAGAACTAGCGACTGCGTTATTGAAACAACCGCAACAGGGGGAGCTGTTGTCGCAAGCTGCAAATACTACGCCCGTGGCGTTGCCGCCTGCT
CGTGCACATGCTgatgctccagctccagcaccaactACTGCTGGTAGCAATGGATTCCATCGTAATGATGCAGCGACAAACGTGGACAGAACGGCGAAGG
AACTGGACAATGAAATCAACTCACTGACGAGCCAGCTTTCGCTTGAAGAAAAACGGCCGCGACCGCTATCACCGCCGAAGAATACAAAGTGGCCAGTATC
GGCCGGAACACCGCCGCCAGTGTCTACCCCGCTAACACCGAAAAAAGAGTGGAAAACTGTTGAATCAGCAAAAAGAACCCCAGGGACTCGTGCTGGCAAG
CGTCCCCAGTTACGTCTCAAGCTGGAAGACATGCCTACGCCTCAGCAAGCTGAAGAGCGGGCTCAGCGAGCGGCAACTCGACTCATTGCGAAACGAGATG
CCATGGAGGCCGCTGCgattgcagcagctgctgcatctggaTCAACTACCCCCGTAGGTGGTCCTAGTGCCGTACAGCGGGCGATGATGAAATTGAATTT
TAGTTCCGGCTCAGAATCGGATCCTCAATCTCCAAGTGGTGCGGTGTGCTGGCGTTTGCGGATTTTGGATGTAAGGTGCTAACTTGCTCTATGGCAACGT
TGTGCTCTGGATGTGAATTGTATAGAAGGCGGGCGGCATAGTGGTGGAAGTGCCTATTCTCCTAATCACGGCATGTTCACAACCAAGAATGTAGCTGTAT
CAGAGGCTGGCATTTCATCTCCCGATGCTGCATGCCTGCACCTGCAAGAAAACCTTGAGCGTGTAAAAGAGATCGGCCGGGGCGCTTCTGGTGTGGTATA
TAAAGCTATCCACATCCCAACATTGAAAGTAGTCGCTGTCAAGGTCAGTGCGTTATCTTGTAGGCCCACATTTGTGTGTTGTTGCTGACATTTGGTGATG
TTGTCTCTTTACGTGATGAAGGATGTCCCTGTTTACGggcgcggccagcgccggcaaATGGTTCGCGAGCTCCATGCGCTTTATTCAAACCTTGTACCCA
TGGCAGACACTGATAGCCCGCTGCCTCGGCATCCTGCTGCCGGAAAAAGTACCAGCAAACCCAAAGCGACGTAAGTTACCATATCGTATTTGTTGCTTTA
CACTAAGAAGTACTATCGTTTGGCTGACAAAAAATTCGCTCGTTATCTGCAGGCCCAGTCCCTACATCGTCTCCTTCTACGATGCATTTGTCGACCGTCC
CAAAAACTCCATTTGCATGGTGATGGAGTACATGAGTACGGGGTCACTGCAGGATATTGTTTTGCGCGGTGGCTGCCAGAAAGAAAAGGTCATAGCGCGG
CTAGCAACGGGTGTATTGCACGGTTTAGCCCATATCCACAACAAGCGAATGGTACATCGCGATATCAAGCCGCACAACTTGCTCACTAACCGACAAGGCG
AGGTCAAGATTTCGGATTTTGGTTTGGCGCGCACTCTGAATGATAACTCCACCACGACGAAGACCTTTGTGGGCACGCTTCTCTACATGGCCCCTGAACG
GATAGGTGGTGGCGATTATTCCTACCCAGGTGAGTCGATGTCGGTATATGTATTCGCTTCTAGCAAAATATGCTAACTGCTTGATTTCTGCGGCAGCTGA
TGTCTGGTCCTTCGGACTTGCCCTGATATCTGTTGCATTGGGTCGCTATCCGCTTCCGACGCAGGACGGGTTCTTCGGCCTGGTTGATTCCGTGAGTTAT
TGTTTTATGAGTTGCGCTTTTGACATGTTTGACTGACACGGTGATAATGCTCCTTTCAGGTTGCAAATGAGCAATGCCTCAAATTACCAGCTGAGTCATA
TTCAGAAGAATGCCGCTCGTTCATTGATCAGGTTAGATCAATGTTGTGGTGGATTCTATACGTTTTGCGAATAGTGTGCATGTTGACGCCTGTGTGTTTG
CAGTGCCTAATAATCGACCCAGATGAGCGACCATCGGCAGAAGCATTACTCCAGCATCCATTTATTCACAAATACACCGCCGAGGAAACCCTTGCAGAGG
TAAGTTTTCTGTTGGTTAACCTTACATGCAGGTGTTATGGTGATCCTGACGAGACACATTTGTGATGTAACGCAGTGGGTATCGTTCGTCGACAGAGGGC
ACCTctgtgaagaaggcggcagtGAGCTGGAATCTCTGGGTGACGCAGTGTATCGCCACATGTATGAACACTCGGTGAAGTTCTCGCATCTGCCACAGGT
ACGCTGATCGAAGTGTGTTCGTACGTCCCTTAGTTGCGAGGTTTGTTCTAAAGGAGCATATGTGAATTCTTGCTGACTATGCTCGCAGTCCGATTACGGG
GTATCGTTCGTGTCGCAAGCGACCCCGACGTTCTCTCGTCGGCAAATATCTCTTCAGCCAGTTCAAATGAGGTATGAGCAGTTCTATTGTTCAAGTCAAG
CAGGGGTTGTTTATCGCTGGAAGACTGACTCGTTGTGCTCTCCCTTTTGCTTTTGTTATTCGACAGTTTACAGCTCGGTCTGGCTAATTACCTGGATGCT
CCTGTGCACTTGGTCTACGAGAAATTCGAAGAGGTGCGTGCATGTGCTGCGAAGATGTAGCTGAGCAAGCATTTGACTTACTTAACTGAGCTTGTGCAAT
GTAGAAACGTTGTTTTTACAGCGACAAGCTACTGGAAGATTATTGCTACTCCCCACAGAGCTGGACGGCCTCACCTGGCATCTCGCGCCGTCAACAATTT
GGTATTGGCACTGATAGTCCGCAGCGCACACCAAGCGAGAAAGGCTCGTTCTGGAGAAAGTTGCAGGAGAGTATGGCAAAGCTCGGTCATAGCAAACGCA
GGAAGGAGCGAGAAAGAGGGCGTTCCTCGGCGTTATAGCTTGGGGCTAAAAGTTCGCCACCGTGGCGGCAAGGTAAATACAGCAGGTCCGCAAGAATTTG
CATACCGCGACGTTAATAAAGACATCAGACGACGATATAATGATACTAGTGAAATACGCCCTTGTACTTCAAACGGATGTGCGGCATGCAGACAACTTGC
GTATGTAGCATCGACAAGAAAACGAGTGTCATTAACAGGCGTCGTGATGCTATAGAAAGGTGTAATGAACAAGCAAGCGCAGTACCTAGTTCGCCTCTGC
AGGATTAGATTGCGGTGTTCCTTTGACGATATCCGTCGAGTGGAGCGTTGCGATACTTTGGCACGGAacggcgaagagctccagtCCTTTTGCGTGATAG
AACGCCTGCGATCGTGCCAGCTCGCTCACGATTTTCTGCGGTACGGTAGCATCGATTCGGAGGTTGTCAGGATGAAATAGCTAACAAGACTTGCCAACgc
accttcatcttctgAATTCGATAGCGGTCGAAGTTGTCCATGTGTGtatccagcagcgcgttgacATTTTCCACCCGCCGCTTCTGGTCCGACAGCatcc
gcagcttcttctccttctccttcgccgaGCTTCCTCGCTGCAACCATCATCATTTCAGCAGCCAGCTCAGCAGCCCGTAGTCTCCTCATGAGCGCAAGCC
CACGTACCCTCAGCTCGTCATACTCCTTCTGAAGCTTAGCCTCGATCTTGATGGCCTTCTCCCGATCTTCCAGCAGTCTCTGCAGCACAAACTCGCCAGC
GTGAGAGAGAGATTCACCTCCCACGTtgtcctcttcttctccttctgccgCGCACCTTCATCGGCACGATGGCCCAGTCCTGGATCTGCGTGACGACCTG
CAGGATCTCCGTCTCGGGCCGCAGCATCATCACGTCGTGGCTCTCactcgccagcttctggcCGCTCTCGCCCAGGCTCCCGAGACACTGCGCCAGCGGC
GCGCACTCTTCCTGCGCCGCGATGTCCTCCAGACTCTTGGCGAACGCGCCCAGGAAcgtctcctgctcctcccgcgccttcatcatcttggccaccagct
cctccagcgcgcgTCCGTTGCGCTCCATGAACTGCAACTGCGCCGCGAGCGTCCgcccgcgctgctccatggTCGATCCCCTCAATGATATACAGTCCAC
TTCAAGATACGCGCCACACCAACGGTACACAATAGTGCGTGGCAGTAGTGTACTAGATACGATTATGTGCAATTTGTGTGCACCAGTTAATTCGGGGCCC
AACGCCTTCACAGTTTCCAAGTTCCAGCGTCGGCGCCTCCCTCCACCTCCCTTTGTGTCTCTGTGTGGCGGTGCtgcgcccccccccccctctgTGGCAG
CCATGCGGATCATGATCAAGGGCGGCGTGTGGAAGAAcacggaggacgagatcCTCAAGGCGGCCGTGATGAAGTACGGCATGAACCAGTGGGCGcgcgt
ggcgtcgctgctgtcgcgcaaGTCGGCCAAGCAGTGCAAGGCGCGCTGGTACGAGTGGCTGGACCCGAGCATCAAGAAGACCGAGTGGAGccgcgaggag
gaggagaagctgctgcacctggccaagctcatGCCCTCGCAGTGGCGCACCATCGCCCCCATCGTGGGCCGCACGGCCGCGCAGTGCATGGAGCACTacg
agcggctgctggatgcggccCAGCAGAAGGAGGGGGTCGAGGTGAGCGACGACCCGAGACGTCTACGACCCGGAGAGATCGACCCCAACCCGGAGAACAA
GCCGGCGCGCCCCGACCCCGTGGAcatggacgaagacgagaaggagatgctgTCCGAGGCCAGAGCTCGTCTGGCCAATaccaagggcaagaaggccaag
cgcaaggctcgcgagaagcagctggaggaggcgagGCGCCTTGCTTCGTTGCAGAAGAAACGGGAACTCAAGGCGGCCGGCGTCATGTCGTCCAACCCGA
AGGTGCacatgaagaagcgcaagttCATCGACTATGCGACCGAGATCCCGTTCGAGAAGAAAGCCCCGGCCGGGTTTTACGATGTCGCTGAGGAGAAACG
GGTTTCTAGCAAGGGCATTGACCCCAagcgtgctgcgctgcagctggacaagctcgagGGCGTGCGTCGTGATgcgcaggagaagaaagAGCGCAAACAG
GatgccaagaagcagaagtcGCTCATGAAGTCCAACCTGCCGCAGGTCATCGCTGCGGTGAATGAGAAGAACGACCCTATCAACGCGATCAAGCGCACCC
AGCTGGAATTGCCGGCTCCTGTGGTTTCCAACGATGATTTGAGCGATCTCGCCAAGCTGGGCATGCATGCTACtcacgccgccgctctcgctcttgAGAA
TGGTTCGACCACCGAGACGCGTGCGCTCATGGGTGACTACAGTGCCACGCCGCTGCGCTCCGTCACTAGAggtgcggcggcgacgccttcTAGTCGCGAT
GTGCACGACAACATTATGCAGGAAACGGCGAATCTGCTTGCAATGCGAAACAGTGCCACCCCTCTTCTAGGTGGTGATAATGTCGAGCTCTATGAAGGAA
CAGGTTATGCGGGAGCTACCCCATCTCGGACACCCTCGGCGGCAGTCAGCGACAAGACGCCGATGTCTGCTACGCGCACACCCTTGCGCGACGAGCTAGG
CATCAACCCAGAACAGCTTTACGGCACAGAAGCCGAGAACGCTAAGGCGGAAAAGGCCCGGGCAAAGCGGCTGGCTGTTAGCTTGCGTGAGGGTTTCGAT
AGCCTGCCCGCGCCTCAGAACGAATACGAAATTAATGTTCCGGAGAAagagaaggccgacgacgatcgtgccgctgctcttcgcgaGGAAGACGCTGGTG
AGCGAGCGGCTCgtgagcaacagcagcgcgagttgGAACGAGAACGTGAACTCAAACGACGGTCCTCTGCTGTGCAGAAGGGGCTTCCTCGTCCATCaaa
ggtgaagaaggtgtTGATTCACAGTGCTGTGAACGAGGTTGCAGACGAGATGTATCGAATGCTGGAGCACGATCTTGCCAAATATCCCGTTGATGATGGC
AAGGcaaagaagagcaagaagcgaAAGAAATCCTCGAGCTCGGTTGTGGTTCCTCACCTACAGCAATTCTCTGACAGCGATAtggagcgcgcgcggcaAA
TGGTGCAGATCGAGGCCAATCTGGGTGGCATGAACGACGTTTGGAAGTCTCAAGACGCCTCCGTTCTTGGTGCGAAATGGGAGGAAGTGCAAGCACGCTA
TTTAAGCAAGGCTGAGGGCGAAGGAAAGGGTGCCGGCGTGTCTTTCGAGTTTGCTACCTCTgacgaggacaagctgcGTGCCGTGCAAGCTCGTTTTGAG
GAGCTCAAAGAAGCTGAGCAGTTCCTTACCAAGCGCGCACAGAAGCTGGATGAACGTGCGCAAGTCGTTAATGGTGGATTTTACCGCCGCTCACAGCAGG
GCTTGGAGCTGTTGCGCGACCACATGACCGAGCTTCAAAACGCTGCAATTGAGCAGGCATGCTTCGAGAATTTGTCAAGTCTTGAGACCCAGGCACTGCA
GAGCCGAATGGCACGACTGGCGAACGAGGTgaactcgcagcagctcagtgAGGTCAAATTGCAGAAACAGTACGCGGCACTGCTCCAAGAGCAGCAGTAG
TGACATAAATCTCAGTTCTTCACCTTGTCCAGTTAACCTCTATTCGTATTTCCTTTCTGACCTCGCCCTTTCAAGGGATGGCTactcgtcgtcagcgtca
gTAAACGACAGAATGATTTTCGCAGACGGAGATGTACTTCGGCCTCGGCCGATACGCAAATTCTCAAGCGAGTACTTGCGGTGCATGAGACTTACCAGCG
TTTTGAGCTCGTGCCACTTCGCCGACATGGTAGACCTGTGGGCGTCGGCCAACTGGTCAAGCTTGCCCAGCATAATTTTCATTTCCTTCGGAGTGAGAAT
ATTCAGGAACGCCTGCAGTGCGAGGTCCATCAATGCCACCTTCTTGCAAAGTAGGTCGAACGGCGGCGTTTTCTTCGATTCCTTGGTACTCTTGCGTGTC
TCCACGTACTTGCTTGTCAAGTCCTCCACAATGCCAGCAACGATGTCCACGACCAATCCACTTTGGATTGGGAATTTCAGAGGCCTCTCAGATGTTGCCT
ACGTGCCAATAGCACGTTAAGATAAAGACAAGAGTTAGCACAGCACCATCGAAAACAGAACGAAGTCCGGCACTAGGCACGACCAGGCAAATGAACGTAC
TCCCTCTTGTGGGACTTTGTCGATTCGATGTTGCAGAACGTAGATCGCCAGTCCTGTGGTGAGCTGTGTGCCACGCATTGTGCGTGGAAGGCGGCGCGCG
ACCGCAAGCCAGCCTGCGGCTGAATCAAACAAGCCTTCGTTTGCCCCAGCAATGCGAAGAATGAGCTGCGGCGCCCACTCCCTCCGCCACTCGGCACGAG
GGAACACGTCCAAGAGCTCTTCGATACAGATGGTAGCCAGGTCTACGATACTGGCATGCATGTCGCTCTCGAATTGCATTCGCAAGAAAAACATGGTAAA
GCTGAATGCGTCGTAGCCTTCCAacttcagcgtcttcgtgcgCAGACAAAGCACCAAGTACATCAGCACGTAGTGCATATTAAGTGTCGGGAATGGCAGC
ACACGCGACTTCTTTGcggccggcggcgtcgctgggATCTTACTTTTCACGCTCATCGATCGTTTGCTGTCTTGGAAGCCGTACGCGCGGAAGGCGTTGA
GGAAGTCGTAGATGGACGGCCCCCACTCCATCTCAATAGCAGGGACCTGTGTGCCAAACGCTGAGCGAAAATCCTCGATCGGGTGGGTGAAACAAGCCAC
AGGCAGAGCCGAGCTTAAGTTCGGGATAGACGTCTTCTTTGCCGAGCTCTGAACCAGGAAGAGATTGCTGAAGCAACCTCCAACCACGTGGCTGTTGCTG
TGAGTTGACACTACAGACACAAAATACAACAGAACCCATTCATCAGACCTCGCTCTAGCCCCCGCCAGTAGCTCCGCAAACCTACTCGTCATAAATAACC
ATGGCCCAATCTTCGAGGGCAGGAGAATTGGGGTCATCGCAGAGCCTCTGGTGGTCGATTCACTCTGGCGCTTGAGCATGCAGCGGAGCAGGATGGCTTT
GGACCACAGCAGCCCGCtcagctcttcgtcgtcagtGGACTGCATGGTCTCGAACACGAGCTTGAGgtcgctctgcagctcgtcctccgtggCCTTGTAC
GTGCGGTacggcagcgactgcagcacgcaaAGCGCAGTTAGTCTCACACACTTTCCAGTATCTATCTACCCGTCCGCCTCTGCATCAGGTGACGCACCTC
CGTCATGGGCGTGAAGACGTAGCCGAACTTCTCCTCCGCGACCGTCACCTCCGAGGCCGAGAACAAGTAGCTGTCGCCCGAGAGCGTCGACATGTTGCTG
TCCATGCTGCTCATGAGCTTGCCCAGGGgcgcgtccttctccgcggcctcgctctcctcgcGCATCTTCTGCATCTTCCTCTCGCGGTtgtcgcgcttgc
gcttctccgcctggtcgttctgcagcagcgcgtccaggctcgtgaactcgtccaggatggcgctggccttctGGCGCTTGCcgcggctgcggcgcgtgTC
TCGCACGATCTCCTGCTCTCCCTCGGATGAAGAGGCCTCGGACGCCGCCCGACGGCGCTTGCGGCTGGCGGCCGGGGGTGCcttggcggcgcgcgtgcGC
GACGGAGCCGCTCGAGCCATCCGGTCTAACTCCTTACGTTCCCTTTTAGGTTGCACTTACAGTTTAAGGTGCCCTTGAAGCTTAAGTTGCTCACACCGCA
ATCGCCGTTTTTAAACAATTCACTTGAAAGTGAGTTGTTTTCGACCAATTCTAAAATGGATGCATTATGACCAATCAACATGTTCGCTGTATACTACAGT
ACTACTGTTTTATTCGATGTGTATAcagtcgtgcacctcgttTTTGGCACCGCTATAAACGTATAGCCGGAGATAGTCTATAGCGAAATCGACACATTTG
GAAGTCAAAACAACTCCTGAAAACCATAAATTTTAGGCTTATATATGGTCCACCATGCTGAAAACGAGGTGCACAACTGTACGTACGTACTAGTTTAAAA
CAGTAATATACCATCCCTGTTTTAAAGTAGACACGACTGTCCACCGGAGGACAAATCTGCAAtggacgttgaagtggaagtACTGTATCGCCACGGATGA
CCACAAACTTGCAGCGAAAGTCGAATGCTGCAAGCCTACCATCGATCGGAGGCAAAGCAGCATCCCGTTCCGCTGCGTCAAATTGACCTGATTGACGGCG
TCAATCAGGGCATTCTGGATCGTTTGAGGAGCGCGTCATTTGAATTTGAGTCtgtcagcagcttcctgcaACGTCAGTGGCGCTCAAGTTTCCTGGGCAG
ACATCGGCGACCCAGACCGTCCAGGCCTTCGCTTCGGCTCGAGGTGCCCCTGGGATCGCTCCGCCGGCGCGAACGCAGCCGAATGAGCCAACGTCGAAGT
ggtctcgctgctgcggagcgGACAGCCACACTTGCGACCCAGCTCATTTTCTCGCCACGTAACGCATATCGCATTCATCGCGTGTCGGCCTAGCACATCC
TGAGGGAACTGCACCGCTCGTTGACGGCTCGCGTGCTGATGCGTCCTGCGTATTTTGGTGCGGgtcgtaccgtgttttgaTATTTTGGTGCTCGTTTTAG
TGCTTCCATTTCTTTGTGTCGCGTTCTGATTGGTGCCAAATGAGGGCTTCACCCGCGCTGATAGGTGGAAACAATCCGTGGAACAAAACGCCAAAAAAAC
ATGCGATTGAAGATCGTGATGCCTGTCAGTCAGCCGCTCGGGCGTCTGCGCCCTCATTTCAACCGCAGGCCGCCACCGAGCGCCGTTGCTATAATAGCGT
GCGTGTCATCCGAGCGCGGCCCGGGATTTGCAGCCCCCAACGCCGTCGCTTCAATCCCATTGCGCCTTGCGGCCGTCCATTCCTAAGTGGTCGCGCCCTC
TTGCCCGTCTGTCAGTGGGAGAAACGAAACCCCCGGCCTTTGAGCGCACCTCGAGATCCTCCGCAGCGAGAGTAGGCGGGACCCCCCACGCGAGCAAAGC
GCCCCAGgtcacgagcggcagcgtctgctACCCGTTGCAGCTTTAGGTCGGCAAtccagtagcagcagcagcccccccccccttcccCTCGCTTCTGTAT
GACGCAAGCCAATCTGCACGGGGAGATCGAAGGAGAAGAGGCCCGAGCGGGTGCGTTGTCCAGACTCAAGCACAGTGCCGCCGGCGCACTGGAAGTCAAC
ATGGCGGAGCCCACAGGCGAAGCTGACGCCGAGTGGGGACAAGTCTTCTCGGCGGGGGAGAGCACTCGCAGCTTCGTGGAAGGTAGGTCTCCTGCTGCTA
TTGGCCGTGGAGGGGGCTCGGTGCGAAATTTAAAACAAAATGCTCttgctcctcgtcgatggcTCTGCAGCCGAGGTGATCTCTGCTATCGAGTACGACC
GGTCGGGAGACTTTCTAGCCACAGGGAACAAAGGGGGACGCATCTCCATCTACTGCCGCCACGGGAACCCGGCATCGGTCAGTTTGGCGCGAGCATTACT
TGGTGTTTGCTGTGGTGcgtgcgtgtgtgtgtgtgtgttttaAGCTAAGTTTGTACTGTGATTTGTACTTCAGAACCAAAGCATGTACAGCGGGGCGAAT
GGCGACCCGCAGTACCAGTTGTACACCGAGTTCCAAAGCCACAACGCCGAGTTTGACTACCTCAAAAGTCTTGAAATCGAGGAAAAGATCAACCAGATTA
AGTGGTGCCGACCCTCCAATGGGTCGCAATGCGTGTTGTCAACGAACGACAAAACCATCAAACTGTGGAAGGTACACGAGCGTAGCGTGCGTGAAGTCAC
GACGTACAATGAACAAGGCCTTGGCCGCGTGCCGCGGGCGCAGATAACGCCGGAGCTCATTCGGCTGCCGCAAACTCACGTCCGTGGGCAAGTTACGACA
ACCACAGCTAAACGAGTCTACGCGAACGCGCACACGTATCACATCAACTCTATCGCGATCAACAGTGACGGGGAGACGTTCATGTCGGCAGACGATCTCC
GCGTGAACTTGTGGAGTCTCGGCGTCTCGAATCAAAGCTTCAGTACGTGGTTGGTTGATACTCGGAGATTAAAGCAGTCGTTGGTGGCTATTACTCTAAC
AGTTGTGCGTACTCGTGTAGATATCGTTGACATTAAGCCAGCGAACATGGAAGAGCTCACCGAGGTCATCACTGCTGCGGACTTCCACCCGacgcactgc
agcacgaTGATGTATAGCACGAGTCGTGGTGCCATCAAGCTGGGTGACATGCGGCAATCAGCCCTGTGCGACTCATACTCACAAGGTTCGTTGGTCTTTG
CGATTGACCGTCGATATCAAAGGCAACTTATCGATTTGGGGTTGTATTAAACACATGGGATGGAATTGCAGTCTTtgaagagcaagaagaccCTGAAGCT
CGAAGCTTCTTCTCTGAGATCATCGCGTCCATTTCGGATATCAAATTCTCTCCAGGCGGTCGCTACATCATTGCACGTGACTTCCTCACGCTTAAAGTCT
GGGACATCAACATGAACTCGCGTCCAGTTCAAACGATCAATGTAAGGAGCCATTTGAGGGTAAACACATGGTACTTCGGTTGCTAACTTGTCGTACTGGA
CGCTGCTCAATCAAACAATTAGATCCACGAGCACCTTCGCCCACGGTTGGGAGATTTGTACGAAAGCGACTGCATTTTCGACAAATTCGAGTGCGCGGTC
AGCGGGGACGGCAATAACTTCATCACGGGCTCGTACAACAGCGAGTTCCATATTTATGACCGCTATGGACGCGCCGACATTTCCATCACGCCGCGCACCG
CGCGGGTGAGTCGACGCCACTCCATGCCGCAGCGAGGTCTTGCGCAGCAAATTGCCGCGATGCCCGCTCCAGGCGACCCAGACGCATTGGATTTCTCCAA
GAAGATCTTGCAGACGAGCTGGCACCCGTCGCTGAACGAAGTGGCTGTATCGATCCGCAACAGTCTCTTCGTGTATGCTTCCTAGGCGAAGCAGAGTGCC
GGACTCGCCGCTACACGCAGTAGTAAtaatcgcagcagcaaaatctCCAGATGGTAAgagagcgcagcagcacgcactgGATTCAAACAGCAACGAACAC
GACGCAAATGAAGTACGGCCCCTCTATTCCAAGCCAGAACGCTAGGTCATTTGATGCTTTGTCCTGGAGCTGGGTCGGTCTCTGTGAAAGTGTTTCAAGA
GGGAAGTACCACGAACAAGTTCATCAACAAGAAAAATAATTGGCAAGATTCGTCGTTCTTGGTTTGTTCaaattttttttttttggtATTCGGGATCGTG
ATAGTACCGCTCACGAGTACCGAAATGCTTGCCATTCAGCTTCAAGCCTAAGCGAGTTTTGTTTCTCTCTCTCGTGTTTGGAAGTAGACACCGCCGATCC
ATTCGTGCGTGGACTGCAGATGTAGATATTGTCTCTCCTTGGGTGCGGGGACTTCCAAGGCTCGGATAGGCACAGTGgggaagctgcgcgagtcgATGTA
GCAGCGTACTAGAGGGGAAACCGGAGGGGAAACCCAGCGCGTCTTGCACACTGGTGACGAGCCGCCATTCAACGTGAAAGGGTATCATCTACCCGGAAGC
GCCAACAATTTGGCTCGCGCAGTGTCTGACCACAAGTGTACAAtaagctggaggaggtggtaCTGCGCTGCGATGTATAACACTGCTCAAGAATCACGAA
ATACTGAATAATGTCAATCCATAAGTAGTCGAAGTGTTCCGCTTTCATGATTAACTTGTGCTTTTCATTGGAACCGCGATCCTGCTATGGCACCATGTAA
TCAGGTCAGGATggccttgaactcgtcgaatTCGATCTCCCCGCTACCGTCCACATCCAGTTTGTTGATCATTTCCTCAATATTGATAGTAAGACCGAAG
TCTCCCTTGATGATTTTCACGAGTGTCTCCTTGCGCACGAACCCCGTTTTGTCTGATTTGCCGCCGCATGCAACAAACGCGTCAACTGGAAATAATAGTT
AGCATTCATTGTCAGCAGCAATAAGAGGGAATTCATTGTACGTACTCATGTCGCTATCATCTTCAAACATGGCGGCTCGATCCTTTTGGTTGTCGATAAC
CTGCAGGAACTCAGCAAAGTCTAACACGAGTACAGTGAGTCTTGTGAGTAAGATGCTGGAATCACAGAGCCATTGAGTACCGATAGCGCCGCTCATATCC
TCATCAACCTCACTGATCATCTGGAACAATTCTTCTTCGGTCGGCTGCTGTCCCATTGCTGATCCGAGTCAGTAAATACAAAAAGCGACAGTTTCCAgca
agcgccagcacgtAATCTACCTTCGAGCACCTGTCGTAGTTCCCACACATCGATTGTGCCGCTCCTACAGTTGCTCAGCGTTAACGACCCACTAAACTTC
CGTGAACTCATCAGCAATGCACGTACCGGTCCTTGTCGAAGGCCAGGAACGCCTCTCGGCAAGCGTCGATCTCGTCTTGGGCGAGCACCATCGcgatgtc
gctgctgcgatcgCTACTTCCGACCAGGCAGGCTCGACCCTTCACGAAACACCAAAAATGTTTGCGTGAATAACTGACTGTGGATTGTGGTACGACGCCA
CGCCTGTGGTCCACCAAAACCTGAATGCAATTATTGAGTTCCGCGAACTTATCAGCAAACTGAAAAAGGTAACAAGCCACTGCTCAATCAAATGGTGCGT
GCTCCGAGCACTTGCTGCGGTTGAAGCCCAATGGGGATGATGTTGTGCAGCAAGTAGTTTTCGTTGTTTGCCTCCACATGCGCCAAATCATACTTGTAGT
TGATCATCATCCCGGCGCTTTGAGCAAGACCCTAGCAAGTGTGAGCAGAGTGCCCACATCCAATGAGAACCTGCTATGCAAAGGCGATTCAAAGGCTGAC
CCACGCACCTTCTTAGACAAGTCTGCCAGCCAGTTGACCTGCTCGAAGATCGCTCCATTTCGGACGTGAAAGTTTGTGACAGGGTCCAACGCCTTCCCAC
GCTTTTTTTCATGATAGATGTAGCGCGCACCAAGCTTCAACATAATAGGCTTCAGCGCTGCAACCAGCTCCGGGTTTTCGCTCCAGTCATCGATCGAAAG
TGCACCCAAAACAATGGCCACAGGAGTCGAGTCCGGTTGGATGACGGTGCCACGCTCGTCAAGCACTCCAATCAGAGCATCCAGTTCGAGCAGGGATACT
AACGACTCATCAGTCTTGTACCGCTGTGTTTCAAGCCAGGGAATAAATTGAGGCAATGGGCTCAAAGTGGCAAACGTTGCCAGGTGCGGGTACTCTGTCT
TCAGAGCTTTGGCGACCTCTTTAATGAGAAAGTTGCCCAAATCCACACCCTGCAGTAAACAACAGACACTGATCAGTTAGCTAGCTAGTGTTCAACATCA
TAGGCAATTTTAGACGCGATGCACCCTACCGAAAGGCCTTTCTGCGTCGAAGAGATGGAGTAGAAGATAGCAGCTTTTGCTTGAGAAGCTTCTGATAATT
GCTCCGTTTCGTCGCGAATGGACTGCATACTAGAAGCGATCTCTTGCATCAATGCTACATGCACAAAGACCAAGGGCTCGTCCGGGATACTACAATGAAG
AAAGCACACTCATCAGGTCATGCTTGAGTTCCAATGCCATTAGTTACAGAGGTCTTACCTCGGATGAAAAAACGCGAAGCAACGGCGTCCATTACCTGAT
AGGGGCAACATTAACAAATAACCGCGGGCATTAGTACGTCTGCTAAGTCAGTCAATGCACCGTATAGCAATCTGGATCGATTAAATTCATTGCCAGACGT
ACCAAGTCGCCTCTTGAGCTCGGCAATCGTACCCACAGGGTGTACCGCTTCGTAGCGAATGATCTTCTCCAAAAGTTGACCAGATGAGTGCTCATAGGTC
AAACGTTCCAGCTTCAAGAAACCAACGCTAAACCATGATGCCAGAAAGTGCTATTCAGAAAAGCAATGCACCGATTGTAAGCAACGTGCAACCCGTCGTT
TTAAATGAGAGAAACACACTGCACTTACTTTTAAGCTTGCATCAAGTGAGCGAAGCGCAGGGATTTCAGAATGGGTGGCACTCTTACGCAGAACTTGCAG
CAGGTCCGCGCGCATGTGCACCAAGAACAGCATGCCGTTTTCTCGTTGAGACAGGATCTGCTGGAAAAAGGTCTATGATGATGTCGAAAATTGTCCGATT
GTCAGCATTATCGAGCGTTTTACAATCACTTCAGGCAGGGGTTACCTCGTAAAGCGGTGACAGCGCGTTGCGGAGGTTGCGGAACGTGCGCAAGTACCTC
TCCACGTTCTCATGCTCCCAGTCCACCACGCTACTGCGAGCGTCCTTCACGTTGGTCATGTTCTGCTCGAACTGAACAGCACTTTGTAGAGCCTGCTCAG
CATTAAAAAGAATAGCACCATCACCCGtcaacggcagcagcactatGCATGCGTCCAAGACAGACCGCAGACAcccaccgccgccgtgtcGATGTGTAGG
TCCTGCGCCAAGATGAGCAGGaactgcttcttctcgtcgatgtGCATACCTCGGAACGTCGTGCACAGACTCTGGATCACCACCTGCGGCACGAAGTCTG
CCTCAAAAGAGCACGCGAACGTCAATAGCccgtctctctctctctctctctctctttgTATCATCTCCGTACGCACCGCCGGTGTTGGCCTTGGTCTTCA
CCACCTCCTGGATCAGCTTGGACAGTTTCCGCTGCGACGCCGCGTCGCTGAGGTCGATGCTGCGCAGGAACGAAGattgctggcgctggtgcgcCGCGTC
GCCTCCTCGCTTCGCCTTGCTCGGGGCGTCtccgctctcgctgctgctggcgaatAACGCGCGCTGGGTCGCGCCCGTCGACCGCAGTGTCCGTCGGGAA
GAAGCATCCGCAGCTAAGGCGCTGtgcacgtggcgctggagcacaCCGCGCGCCGCCCAGAGGCCGCGCATCGGAGCCGAAGACATCGCTGCGCTTCAAG
TGCAGGTTTATGGGGCAGTTTGTTGAAGTGTcgtgtccagcgtgaagTGTCGTGCCAGATGTGTGCCACCCCACGGAAATGCTGATCAAGCTATAAAGCA
CCAAAGAATTGACTCCGGTGCCTCCCGTCTCTATGATGCTGCGCGGCGGAATGAGGTACTTGTGCGTGGTTCGaggcgcggcgcagcgcggcgtcggcgt
cagCTTCGGTTCGAGTGTGcgcgtgctcgtggcgcgGTCTCTGTCGTCTGCGGCCcctgacagcagcaacatccgCCGCgtctcttcctcgtcgacgtgg
cCCCAAGCCCCGCGAcccgccgtcgtcgctgtgtCGCGCCGTGTGCTTGGCTTCccatcgctgtcgtcgtcgccgtcgtttGCTGTGAGTTGCAGCGCTA
ACTGCCGCCTCTGGTCCAGTGGCAGGACGTCCCGGGACTCGAATGAGACGGCGCCGCTTACGGGAGGAGAgcccacgtcgtcgtcgtccccaACCAAGGT
GCGATCTCCCGCCTGCTGATGGCCGGGGGGATGCTGCAACAGGTTGACGTTGTGGCTCGCTGTTGTGTCGGGTTTTctattgctgctgcagggcggggac
gacgcggagaaggagctggagcagcccACGGAGGAACTTCAGCCGCAGTCGTGGCGCCAACGAGCCAAGACCTTCGCCATCGAGTACGGCCGTGTTGGCA
TCTGCACGCACATtgtgctgtcgctgctgtcgttctcCGTCATATATGTGGGCGTCTCCAGCGGTGTGGACGTGACCGCCATCCTGGACTCGGTGGGCTT
GTCCACGTCGGTCAGTGACTCCACGACCAACTCGGCTGGATCTTTCCTCATCGCCTACACGCTCTACAAGGTGCTGTCCCCCGTCCGGTGGCCGCTGACG
TTCGCTGCCACGCCCGTGGTCCTACGTGCACTGAGGCGCAGAGGATACATGCTGCCTTCGACCACTTCCTCGTCCAGCCGAAGTCCGCCACCACCTCAGT
AACTTCATTGAATGGATTTCGTCCCCAACGAACGCTGCGGAGACCTTGGAGCTCTCTCGGCGCGTATATGCAATAAAGATGATTGAACCAACACTGGAAG
TTCATTAGATTTACCCATCAGTTACACGAGTTAGCTGGTATTCTGTCCGATGGCATCTACTGTGGAGCAACTCTTTTCGAAGGACTAGCCCGCGGACCAG
AGAACTTGGTCACCATAACTGATAGCACTGCAGCGATTGCCTGCAGCCACACTTAActcgtctgctgcacgtgctccTCAAACACGGGGCGAGCCGCCTT
GATGTTAAGGTGGATCGTTGCCGGTTCTACTCGACCAAATTATAAATGAATAATGAGAAAGTGTCAGTGACCACGCAATTGAGAAACACGCAGGCCAAGG
AAGCCCAACCAATAGCTGCAGCTACTTACGGATCGAGTCGTCGGACATGATGATCATGATGTACGTGTTGGCGGTGAAGAAGTCGATGAAGGCCGTAAAG
TTCGAGTTGCGCACCTCCATGCCCTGGAACTGCGCCTGggtcttgctgcagctcagctTGAACTGCTTGATGATGTTGCTGATCTTCTCGAAACGATGGA
TGTCGCGGTGATTTGTGTGCGTGGCGTGTGAGATCACAAGGAAAGTTGCACGCTCAAagagcaccacctcgtcaGCGCTGCAGATAGAGCAGAAGCTGTT
CAGGTGCTTCTCCAGGTCCTGCATGTTCGGGATCAGCGAGTACACAATGGACGACCATGCGCGGTACAGCGTTTCGTCCCAAATGGACGTGCCAAAGCAC
ACCGTCGGCAGTTGACCCGTGCGTGCTAGAATCATCTCCTTCTTTTGGTTGAAAACCTGCCCACAGAAAGCACCCGTGTTTAGTCATATTTCCTTTAGAT
AGGACGAAGGCCTCGTAGCCCATGGTCACGCACGCGCTCTCGCTGGTCCTCCGGCACGAGATCCATCTTGTGGATCAGCACGAACACCTTCGCGTTGCTC
GAGTTCTGGTCGATAGCCTCCAGACAGCCGTCGAAGTGGGCCATATCTTTCTGTAAGGAGCCAACAGTCCATTTCAAAGTCAGCACCACCCTCTTACACC
GCTACTCCCCACAAATCAACCGTACGTCGATCTCGCGGCTCTCAATGTCGAACACGTAgatcagcagctccacacTGCGGAAAATGTGGTCACGCTGGCT
CTCGAAGTAGTTCTCGTAGAAGGCATCCTGCCTGCAATGAACACCACAGCACTGGTGTCAGATTCAGCTTCTGAGTGTATCAATCAACTTCCCGTCGCCG
TACCCGCCGCAATCCCACAGATTCAGCACCAAGTTGCCCAGGAAACGCACGTGCGAGTGCTCCACGTCCACTAGAAAGTAGCAACAGCCAGAATCCCGTC
ATTCTCCTCGTGCCCCTCGACAAAACCAACTACATGCTGCGTATCGGTCGCGTACGCGTGGGTCCCAGTCGCATCGTATCACGAGCTGGTCACACGGCAT
GCAATAGAAGTCAGAGCGTTAGGCATTGCGGTTGGTATCACAGACAGCATCGCGTCCAGTACCCAGATAGTTGGCGAAGATGATGGAGCGCATGGACGTC
TTGCCTGAGCCGGACTTGCCCATCAACAGAACCTACAGGCGGCAGGCGCATGTCGGTCAGTAGACACCCCGCGGCAGCGACGTAAGGGGCTgtgaggggg
ggggcagcCCCGAGAGacgcaccttcttcttcatggcggaGACTTGGTTCGGCCGCAGTCactgcgcttcttgtcgtaTTTTCGGGAAAGGACTTCGGAC
TTTATTATCGCCACTTCGGACTTATTATAATTTTGAGGAAATGATTAATAAACTGGATGCGGACGGTATCGAATTCGACGGGTTCAAGGAGTGAGAGAGA
GGAACAGACTGTCTATTTAACTTTAGGGTATGCAAGATGTCTGGAATTTCCTAAGCCAGGTTAGCAACGCCGGTGTCTGTAATTGATCCGGTGGTTGTAC
GTGGCTCACCGCTGGGTGTGGTGCTGCTTTAGGTTGTCTCATCAGGAGACCGATGCAGAGAAGTAATCGCGTTCCCTGTATCGTGGTATGCGGTCGTCTT
CAAGGAGCGTAGCAGAAGATAAGCATGAAAGAGGAACACCTCGACTACTTATGTATTGGAATTGTATTAAATATAGTTCATGATTCTCGAGAAGTGTTAT
CCAtcgcagcgccacgtactcCAGCCTCTGTCAAGCTCGCTCGAGCGTTGCAATGAATACAAGAACAGTTTGATTGCGGCAGGCCACAGCTACTTCGTTA
GAGACGTAGTCTGCAAATTGTTTTGCGAGAAATCCGCTGCACGGGGAGCATCAAGTTGATACTCTGTAGGAACGTCTGTGGGTAAGTCATCATGAATGTG
AAAGTTGCTGTACGAGACCGTGATGAAATGTTGCTCCCAATCGAAGGCGAAGCTATGGGAATGCAGATACAGTATTTACGATAAAATATGATCGGCACAA
AGGAGCACGATCCAAAAACAAACAGAAAACTACTTATTGCATCTAGAGAACCCACATCGATCGTTAGGGCTGGGCACAAGTTCATCTTGGTGTCCCAAAC
CTTTGAGTGCGAGGAAATCACGG