Description :
From Genome Similarity Track
Location :
Scaffold_1919:1778- 3925
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1919-fgenesh-gene-0.0Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1919-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2147 bases(100 bases per row)
TAAGATCGAGTTCACCCCGCAGCAGCAGCAGTTCTTACTCCAGCAGCAACAGCTCCAGCTGCTGCAGCTTCAACAGCAGCAACTGCAGACGATGAGTCCG
AGCGACCTGGCGGCAATGGCCGCGATGGCGCAGCAGATGCTCGGCATGGTCATGATGCCGATGATGCCCTTCATGATGCCAATGAACCAGGCGCTGCAGC
AAGCGGCCGCAAATCAGACGCAAGCGCAATCGGCAGGCGCCTCGGAGCACCAAGTCGACTCCCCCGCGCGCTCGGCTGGCTCGGGCTCCTCTCCGACGTC
GCACGCGACATCTGAGCAGACGCTGGGTCTGCAGAGTAGCGGCGAATCATTTGCGAGCCAGACGTCGCCGATGACGATGATTGGCGCGCCATTCGCGCTC
CAGGCGGTTGGCAACGACGACACCCCGAAGCGAAAGCGCGGCCGCCCACCAAAGAAGGACGTGGTCGCGCGCACAAAAGCGGAAACGGAGAAGACGCTCA
AGCAATTCCCGATGTGGGGATACGGCATGCCGATGCCGCTTCTGCCGGGCTTTCCAGGAGTGCTCGCGCCTGGTGCGCTGGCGAACCTGAGCGAGCAGGT
CACGCAGAGCCAGGAAGAGGCTACCGGTGCTGCTGTCGCCGCTGCAAAAGAGGAAGACTCGGACTCGGGCTACGACAAGTCTGGACGCGGTGGACGAAGC
GGAAAGGGTCCGGCAAAGAAGAAGACCCGCGGCACGGGCAAGCCGCGCGGGCGTCCACGCACACGCCCTCGTCCGGGTGAGATCATCCGCCGCGCCAAAC
CGCCAACGATCGCGCCGGCGAATTACTCGGTGATGTACAATTATTCCCTCTCGAACCTCGCGCAGAAGAGCGCCGAGCTGAGCAACGAAGCGAGCGGTAA
CGGCAACGGCGGCGCGAGTCACGAAGAGAACCGCTTAGCAGGCATTGGCGCGTCGCTGCTCTCGGGCGACCACGAGTAAGCACAAGAAAGACAGAGAGAG
GCAGAGAGCTGAGGCTGGTGAGACTGGTGAGCCGTCCGTCCGTTGACCGGTGTTCGAAAAGAGACCTGCTAGTATTAGTGTATCGAGAGCGTGTTGGAGC
GAGCGAGCACCTTGCTCCACGGCTGTTTTCTTTTTTTCCTAATGGCAAACAATTATATTTTGGGTATGAAGCACACACACAACTTTCCAATCACATCAAT
CAGGCAACAATCGATATCTATCAACCAACGATCTAACATATTTTATTGCTTGGTGCGTAATGAGCGAATGATGCACATCATGAGAGGGGCTCTATAACTA
AGGTTCCTAATTAAAAGAAGACTTCTTCGTCTCCGTCTTCGCTCGCGGCGTCGCTGTCGTAGTAGTCAAACGTGTAGTCGTTCATGTCGTCGCCCTACAC
ACAAACACATATCAGACAGTCACATAGGCAGGGTTAGCACATAACCACAGTAATACACAGCCCAATGGTTCCAATACGCACCAGGTCCTCGTCCTGCTCC
TCCATGTCGTTGTCGTCGTCGTCCGCGGCGTTCTTGGACTTGTCCGCCTGCTTCTGCTCCTGCGCCTCGAGCGACTTGAACACGCTCTCGAACGCGCGCG
GCTGCATGATGCCGCGCTGGTTCGCGGTGTTGGCCATGCGCACGCCGCTCAGCGTGTTGGACTGGAGCTCGTCTGGCACAAACACCTCGCCGGCCTTCTG
GGTCTCCGGCATCGTCACATGCACAAACGCCGCCGGGTTGGTCGCGTCCGACATCGTCGCGCCCTGCCCCCACGGATGGTACAAGTTCTCGAGCTTGTGC
GCGAGCACGCGCTGGCGCTGGACCAGGTACGCGTCGCGATCGGTCAACGGCTCGGGCTGCGGCAATTGCAGCGGTGGGTACAGCGCCGATCCGCTCTCAG
CCTACGCGGACAACAGCAGCATGAGCAAATAGAAACATGACATGCACGCCAGTTAGTCCATGGTTAGGCATGGTTCGGTGTGTAGATCATAGGTGCTAGT
GTGCGCTTACGTGCAAGAGCTCCATCTGGGTGTGTGAGAGACCGAGGTCTTCGCGCGTCTCATCGAGCATGTCGGCGAGCGCCGAGTCGCGGCTGCCGCC
GAAGCGGAAGCGGCCTCCTCGTCCTCGTCCGCGGCTCATTGTGGGAG