Description :
From Genome Similarity Track
Location :
Scaffold_1505:1778- 3535
Sequence
1757 bases(100 bases per row)
CTCGTAATCCACTCTTCCCCTGTAGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACGTCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCTG
TGGGACCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTCCGA
TTCGTACGATCCCGCAAGAAATCATAGAGTAATGCCCCACAGCTCAAATCTGCCTCGTCTACCCAACTGGGCTCGTCATATCCACGCCAATACACCAGAA
ATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACT
ATCATATGGTAGGAGGACTTCGTCGAATTCCACCGGATCGGATTCAACCACCGAAAGATGGGTTTGCGGCCGGTCCGGATATTCCCTGACCAACTTCAGC
TTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACCGCATGTTCCCCTATCTTTTCGCTCACCAGGTGAACGAACG
GCTGCGGAGTGCGATAGAGGATCGAGCAGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAGGTGGGATCGCAGGTGTGGCTTTATTTGGATCGA
GTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCC
TTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTTGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACC
CCGGATCCTGTCGTGGGCGGTGTATTGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAACCCCTCTGATCCAAATCCTGGACATACACTCTTGAGTGCCC
TCGTGATCGTCTGCACCATGCGCTCGAACGATCCGTTAGCTTGGGGATGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCA
AAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCCCGTACGATTCAGCAATGGTT
TGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATACGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACG
AGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCACCTCGATTGTGGGCCTGCCCTTGCCTGTCTCACA
ATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGT
CCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCT
TCGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTA
CATCCCCCATCGGATACTTCTTTAGTCCTAGGATCCACGCTTCTTCGTTCTGTGCTT