Description :
From Genome Similarity Track
Location :
Scaffold_2506:1778- 3221
Transcript NameFunction/comments
Phyta_totarag14564hypothetical protein PHYSODRAFT_332751

Sequence
1443 bases(100 bases per row)
ATTTGCCCACGTCATGAAGCTCACCACACTCACGGCACACAAAAAGGCAGTGATCCACCAGATGGCCCCGCTTGCCACACTTCTGGCACGTTAgacgtct
ccagcagcccaGAACCGTGTGCTTGCGAGATCCACAATGGATACAGCGGTTGCGATCGGGTCCGTCAGCCTGGTACCTGGATCTGTGATCTGGAGATCCA
TCGGCGATTCATCAGATCGTTTGCGCGCGTGGTAATATTGCCTCGCTACCGAGACACCCAGGCCACAATATTGGATCTGGAAACTGCGCAACAGATCGGT
CCACTTGTTGCGGGTCGAACGGCTCAATTGGCGGTTCCAGTTCCTCGCAGGTCCCGTCAGCAGATCTCCGAAATTCAGACACTTTTCCTCGTCGGAGGCT
TGATCACGCAAGAATGCGGACTTAACCTTGCTGATCCACCCTCTTGCCCGATCTTCGTCTTGATCTTTCCCGGTGAACTCCTTCAGATCCGAGATTGCTG
AGATCCGCACACGTTGGATGAGCGCGGATCCAGCTGATCCGGCCGTTGCTGTGGCCACTGCGGCACGAATGGGTGAGTCATCCAGATCGTCGGGGTCGTA
TTCCCAGAGAGCGGGGTGGCGATCGGGCGATCCGACCGACTCCATGTCCACATCTTGCGCGCCAACGTTCCTTGTTGTGGCTGCGACCGGAGTCGGTGCC
GTGATCTGCTGTTCTTTGTGGAATCGGCTCATAACAGCTTGGAAGTACGATTCCAGTCTGCCTGGCGATCCGTACGGCGAAGTTACGTTCGTGGGCTGGT
TTGGCTGTCTCTGCGGCGGCCTCTGCTGTCGCGGCTGCGTCCGATCCGGTGACTTcccacgagatcgagatctCAATAGTGCTTCTCCAGAAGGTCCGAG
AGGCATACATTGCGGCCCTATAGATCCATCTGAATCAGGTTCTGGTGTGGCCGATACGTAATGTGAAGAGCTAGTCTATTACTCCGTCATGCTGATACGG
GGCGAGATCTCTGGATCTTCGATCCGTTCATTCCTGCCTACCAAGAGCGCTAGTCTAGCGAAAAGCTCTCGGGAAGTAGATTTGACGGTCTCTAGATCCA
GATCGAACAACCCGTCAGCGTCGAAAGCACCGGCAACTAGACCTGTCTCTTTCTGCATCTGAAGTAGGTTCTTCACTGCAGTCAGCTTGTTGGACGTCTC
CGGTGGAGCTGACACTGGTCCCTTCAGATCTCCGATCTGCTCTACcttcatgatcttcatcATTGGATCTTGGAATAAGAACTTGCGTAGCGCCTTGTGG
TGAAACGCATCCTCCAGATCCTGCTCGGTCCAAGTTGATGGTGATTCCCTCTGATTTTCTCCTTCCGACTCAGGggccttcattttcttctgcGTAGTCT
TCACTTTCTTATTCTTCGTATTAGATCTTGGGACTAGCGGGCT