Description :
From Genome Similarity Track
Location :
Scaffold_60:177794- 185579
Transcript NameFunction/comments
Physo_138094hypothetical protein
Physo_109104Avh_1
Physo_158991PsAvh1

Sequence
7785 bases(100 bases per row)
GCTGAATGCACCTATTGTGTCAGTATAGCACTGGGTAAACGCGAAGGCGGTGCCGGTGTAGGCATCGCCCTCTGCCTAATAGTTGTTCTGGTGGAGTATG
GTCGCCTTCTGCGTCGCTTAAGCGACACTGCCCACGCTGTATAAAGCATGATTGGATGCCTTACTCCCCATGCCGCCGCTGGAGGCAACAATGTCGTGGC
CAATGCCCTAGCAGAACCTGAAATATGTGCTCTCGACACAAATCCTTCTATCACCTTTTGCACAAATTTTAATATTGAGTCACCTTCCTGAAATTTCCCT
AAGAAAAATGATGGTAGGCGCTGCAAATGAGGGGCTTCGCCCCTCATTTGCTACTTTGAACATAGTACGTAACCACTGTTTGGTACTGCTAGCGCATGTA
TTAATGGTTGTTGTTTTGGATTTGGCTTAGCTTTGTAGTGGCACCAAAACACTCGACCACTCAGTAGGCGAAGTATTAGCACAACACTTGACTACTTCGT
AGCCAAAGAAGATAGATATCTATTAGTTTCTTCAAAGTGTTCCAGTATGGAAGATATAGTTGTACTCGAGTTGGTAAAATCGAGCTAACGTTAGATACAA
CCGAGCAGACTTTTTGGAATTTAAAGTAGTCCTCCCAGCCTAACGCAACTATCCTGCAGGCTATCCTGCAGGCTACCCTGTGAACGGCGCTCCGTTGGCC
AGCGTCTACAATGCTCCCGCGACGGCTGTCAACAGCGCGCCTGCCGGCACTGGTACCACCTACAGTAACGCCGCGCCTGGACGTGGAAACGCCAATGCCA
ATGCGAACGACGGCAACAACCCCAGCGGCGACTCGAGCAAGACCGTCACCGTCTTGAACGGAGACGGCACGTCCAACACGGCATCTGTGACGAGCAGCAA
CGGTGCCGCGATGACGGGCGGCGCATCGGCGAGCGCTACGGCGAGTGCGTCTGCAAGTGCGTCGGCTAGAGCCACGGCTGGAACGTCGTCTCAGAAGGCG
TACCGTCAGCTTCGTTCGGTGGAGTAAGCAAGTGTGTGTTTAGCCCGCCCGAGTCATCCATCACCGCTCTGGTTCGTCCGGTCTCAAAATACGTGTTAGC
TTTGTTGCTGTGTCAGTTCATAGTGAAAGTCATGCTTCAATCTTATCAATGCAATCGATGTTTCCTCTGATGAACTCGTTGTTTGTGTCAGTTGGTGGTG
TGGGTTATCAATGCTTTGTTGAGGTCGCGTGTACATGTATGTATACCCGCGAGTACCTAGCCGATGTTAGCAGGAGAAACTGTCTGTCAGTGTGATGCTG
TGCTGCTTGTTTGGTTTGGCGTCGGTCACAAAAGCTACGACCGTGTGTTGTGCCGATCTTGGATATCAAAGGTCGCACATCTTTCCAACTTCAACCACGA
GCATACAAACCTCAGTACAATATGGAACATACAAATTTAAGCATAAAGCTTCAGTACAAGATCGAACATCCAAACTTCAGCATACAACTTGTACCGAAGC
CCAGAATAACCGACATCCCATCATCGGGTAGGTTAGCACTCGTTTTTGTTATTGAATTGAGCATTGTTGTCACTTAGCTATACGACTACTAAAGACCAGC
CCCGCAGATGCCAAACGAAGGTTAGCACTCGTTGCCAAGGCAGTAGCATGGGCTACATGCGATAGTAGCAGCAGCCGCAATAATATACCAATATGCACAA
GCCGTAGATTTTTTTAATATTAAAATGGGGTCGTATTACTGATCGGGTCGGGGGATTTGATCGGTCTTGCCTATACACGATTGTAGTGTTAACACTTTCG
AGAGAGGCCTCAGAAAGACCGTTTGCAACCGCAGCGAAGTGGAGGTCTGCAATGGTCGGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCAGTTCTGATA
CAGGTGAAAGGCGTATCCGTTGTAGATACGGTCGTACTTCCCCTTCTGCTTGGGGTCCGCGATTGCCAACCAGTCCTTGATCTTCTGCAGGGTGTACCCG
TTCGTATCCCACTTCTCGTACGCTTTCTGCTCCTTTGAAGGGTCCTTCAGAATCGCCTTGGCCAACTTTTTGGCCCCCGCCTTGTTCCACAGCTCAGTCA
CGCTGAAGGTCCGCTCCCCCGCATCGTCCTCTTCATGAGCTCGAAGAAATCTTCCACCGGCAATGTCGCCGTTCCTGAGCGAGCGACGGACGAGATCTGG
AGATTCCACCATGGAGATATTGGTTTCGTCGGAGTACTCAGTTGCGTTGCAGGTCACGACGTAGCCAATGGCCACGACAAGAGAAAGCACAAAAGATAGA
CACATGGTTCGTGATACTTGGCGACTTGAGGACTTGCTGGCTGGAGAGCGAAAGGAGAAATGTCGTTATTGGGTGGCGGCGGACACAAGTGCTCTCCGTT
GTGGTGGTTCCTCTTGAGCATGCACGCCGCCACTTTTGTTCCAGTGCAACAGAAGGACAAGGGATCATTTCCTTGGATGTGCATGCTGTGGATTGTATTA
TTGTTTTTTTTTTCGAAGGCAACCTCCTCGGTGTTTGATTCTGATCGACAAGAATCAGTGATGGCGTGAAACAGACGAAATGAGCATTTCATTTCGATAA
TGTATCTCATTTAATGAGATACATTATCGCGTAGCCGAAGGTATGGCTGCGCTAGACTCATCAAGAACAACAGATCATCAAAATACGAATGTATATGACT
TAAACACAACAATAGGGGGCTTCCCGAGAGATGCCACGACTGCTTTATCCAAGCCTGATTTCCTTCAATCTCGGTCAACTCTGATGGTGATATGGTACAG
TGTATTTGAGCTCTGATCATTTAATCCGTCTACCGTACGTAGGGTTCGGTCGACTGTGAAGATGATATGGTATATTTGATCACAGGTATTATAATTAAAC
CTTATGCAGAGTAAGCAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCCCTGCTTACTCTGCATAAGGTTTGGTACCTTGCATAATTTGTGCAAATCACGACAGAGTTATCTT
AAGCATAAGCATAAGCCGTCTATGTACTGAATTAAAGAACACTTTGAGGTAATATGTCGAAAATAAAGTATGCCAGATTTGCACTCGGCGATATAATTGA
GGTAACTTATTAATAGTTCTTTGAGTATCGTGTTGGATTCTTGTACCTCTCACTCTCTTTTGGTCCCACCTTTGTGGCTAAGGCGGGGAGTTCTGTAAGA
TAATGTGTGAATGCACTGCCAGCTGGCTGACGCTGTGCGACACCGGACTACGTAGCAGCGCTTATATTTAGAGGCTCCAACACTAGGGCTCCGCGAAGGC
TGGGATAGGTGGATTTTGGTATAACCCCCCTCTTTATTTTATTGATTACTTTTCTTATTAACTACGGTCATCTCCTAGCCGCAGCATCTGCCCGTAAATT
GACCTTGAGACCGTAGATGCCAGATATCAACTGGCAACGCTTACACCAAAATTAAAAATGGGAAGCTTGGCTGAGATCTGTTTGCAGCTTGTAGAAGTTT
CCTACTGAAAATGCAAATGCTTATCTCTAGTGCTATTACAGTACGCCTCGATCGTTCTCTTTACTTCAATTCGTTCACTGCTCGAATATATTTACTGGTT
CGTACCAGTGTCGTCGGTAGCACACCGGTTGGATCTGCCCACGCATATAAACGGGCCAGTGCATCACCGGTTCCATACCGGTGTTATACGTATCGTACCG
GTTCAGTCTGCCCACGCGTATAATTTATATGCGCGATATAAACGACCCATTGCGGCATCGGAGTCGTACCGGTTTCAAGAAAATATACCAGTTAGATGTC
AAGAGGGGTCATCGTTTGACTTGACTTACCACGGATACCGGTATAATCCTATTTGGTCTGCGATTGCAGCACTAACGTTGCTTCCTATCCCAGTATAAAG
AACATTGTAAATGCAAGCTGTTGCGTTCGATTCTTCGTATGTTAGCTATAGTTGTTTGTGTGCCTTCAATACTTTCGTTTCTCAATCAAAGGTGTCTTCC
CCAGTGCAAGGGATCAAAGAAAGATGAGTACAGTACTACACAGCCGACTCTCTTGCGTCAGAATTTATGCCCGAGTGACGGCTGTCAACAGAGGAGGGTG
CGTAACTATACAGATTTGTGGTGCAAAACATACAAACTTGGGGAGCAAACATATTGGTGGGGGCTGACTATACAAACGCAGGCATAACATAACGGCGAGG
GTCGAACTATAAGCGGCCGAACGGCAGAGTTGCCCAGGTCTCTTATCGTAGTGGCAGAATTACCCCGAAGCCTTAGATGCCCGGCAGAATTGCTCTTACA
CTTAGCTGAGCGCCTTAACTTGTACATACATAATCGATTCCAGCGTCTAGAAGTCACTCACGTCTACGACTCGTCATATCGCTTCGTGTACCAACATGAC
TACATGGACCCAGCTCGCTTTGCTCGACAGTGGTGATGAATACGAGTTTTATCGGGACTAGTACATTTGCTGCACGGCAACCTTCACGAAAGTCGACTTC
GAGTTTTGCCGCATCTGTGGTGGCAAACATACAATGGTAGAGCGGCGCCTAAAGTGTTCCAGCAAAACGTGCAGTGGGTTTGGCGTCTGTAGTGCGATTT
GGAAGGTTGATGAGTGCACCGACCAGGATACGTGGCGAATATTGGTGAACTCGAATGGTCACTCACGAGGCGTCCTTCCATGTAATGAGAAGCCCCCCCC
CTTTGGTGACCCGCCCTATGAAGACATTTATTGCTGCACAGGACGAGGCTGGTCTGCCTCCGAGGGTTAAATACTGATCTATGCAAGTGCATCACTAAGG
GCATGGCGCCCACCCATGCCACGAGATTCGGGGCGCGTGAAACATCATTTATAATACTTTGTTGTACAACTACGGTGCTAGGATAAGGGATAAGTTCATT
TGACTTCTGTATTGAAGACGCCTAGTATGTATGACGACTGGGTATTAATTCCTAAGCAAGAATCCTAAGAATTGACAAGATATATAATAGAAGGATACGA
AGGGGGCCAGTATATAAACGTAAGAGTGTAATACACAGAGAAAAATATCTTAAAGCGCGTCATTCTCTGAATAACTTATTATAGGTACCGTACTTCAAAA
CAATAAATTCTTAACAACAGGCCTGCAGTTTGTAGCGCCCGTCGGATGACTTTGAATTAAAAGTGTACGTTATAAACAATCAGAATGCAGTATTGAGTAA
AATCTTAAAACAAAAACTGCAGGTTTATTTAAAAAAATCGGGGCGTTATGATGTTAATATGAGTGCAGTTTCAAAATCTGAAACTGCATTTATTTTTACG
GAAAACATATTTGTGTTGGTACCCGCTGCAATGTGTAATTCAGCTGCATGGCAGAATTATTCGTGCCGAGCGAATTCTGCCCCGTGGCAGAATTACAATC
CGCTTCACCATCCGACAGCTGGTGCTTGTACTGATTTTGTGTGTGTATATTTTGGAACCACTACACCGTTCACCCTAATTAGTCGTGCCATGACTATTTA
CCGTGTACGACCTGAAGAGTGGCTCACCCTGTTTTGAAATTCCGTTTTCGGGAAAACTATTCCTATCTACGATAAACTAAATGCATCACGCAATTCGTGT
TGCCGAGATCTACTCGAATCCGGTCTCTTTTCTGGATTTAAGGTGAAAATGAAAATACTTATCAGAACCGGTGGAATGATTATCAAAGGTGCACGACTAA
TTAGGTCGCACGACTAATTAGGGTGAACGGTGTAGCATGTATGTTTTGCCCGGAAATCTGTTTGGTGGCGACCTTTTGTCCTGTCAACACTGTAGGATTG
GCTTTCAACATTGAAAAATCGGGCTTTAGCACTGAAGGGTTAGGTAGGTCTACAACAACACTGAAAGAACGGACTTCTCCACTGAAGGGCACTGAGCCAT
TTATAACCGTACCAAGGCAAAAACGTGCTAAGTTTGAGCAGCCCACGATCTATTCACGGCTCTATTTTGCTCTTGTCCGATGGCCACAGTGCGTATTCTA
GACTTCGTTCGCAATTGCCTACCTTCCGTGCCGTGCAGCGCGCTTCATCTACAGTAGTGTCCATGGCGACATTTGTCCTTGATACCTCCAACCCGAGCGG
TCAGTCGGATTCGAGTGTAGCACTTCAGACGTCTAGCTGCCAAACTACTCACAGTTCTGCGTGCTGTTCCCGATGGACAGGACTTCGCAACCTTCGCGGC
ATGGAGCGGCCTCCATCCACGATGACAACGCGACGCATGAGGTACTACTAGCAACACTGCGTCCAGCACACAAGCTAAACAGTCTGCACAGAATCAGAGC
GAAGCGAGAGCGTCAACGACCAATCGTTGAACCAGCACGAAGGGGACTGCGATGAGCTGTCTGAGGGTCTGTAACGCGATTCCTAGGCGATGAAAAACTC
CAACACGACAACTACGTCAACGCCTATGGCCTGCTGCGGACAGCTACCCAATTCAGCGTAGTCAACAGGCAGCATTAGCGCCTGCCAGAGCTGGTGACGA
GCAGTACGTACAGCCCTCCAGCGAAGATGTTGGCCTCAACGATCCGATTCAACGACGGACCACCGCAGGTCACCATAGCTCCAGCGACTATGACGACGAA
GACGACAGTGTAGGCGAATGGCACGAGCAATTGCCACGACGTCGTCCTGCTCAAGCAATTATCTTCATTTCTACCCCGCACCGCACATGCCCCTATTTTG
AATTCAACAGTCGCCGCGCAGCTGGTCACACTGCTGCTGAAACTGATACGTAGGCCAACCGTGGCTAAAATGACGCCAAGGCAAGCTCTACCTCATGGCT
GCAACCAGAAGCTGCTACTTCGACATCGACACGAGCTGCACTAGCATCTACTATTCGACTTCAAAACGCGCTGGCCGAGATGCTACTACTTGAACATCGA
CACGATCTGCTCAACCAGCTGCATGTACTACTTCGAAGACACTGGGCAGCAACAACTGCGCCTTCAACATGCCACACCTGGGCGATCTACTTGTCGCGAG
TCTTGCGCGCATACGATACTAGGCATCATGACAGCACTGAATTATTTCTATTACCACATAATTAGTGCTAATACACTGCGCGACATAATTTTTCGGACAC
TCACATTTCTGTCCATATCTCAGCTTCTAGAAATAGTTACAGCTCGCTATTTAGATATGTTGTACCTATCAGATCAATCTATAGCTGGCATGTGACGCGG
AGCTAGATTTTTGAGCGTGTAGATAACTTTCGGACAATTTTTTATCTTAATTAAAGTATGGATAAGAATGATTGTCGTAGGTTGTCGTCTGTTCGTCTCC
TATTATATGGTGTGGACCACCAGCGACGATGATGACGGCAAGGCTGCCTGCGGGGCCGGCAAGCGCCTCCAGAGCGCGCTGTAGCTCCAGGCTTGATGCC
AAGTTGTTGGCAAGCTCTACATGCTACGTATGCACATCATGCCGCTGCCCTTGGCGAAGTCTGGGCCTCCACGGATGGCGCTGTA