Description :
From Genome Similarity Track
Location :
contig_50:177790- 184540
Transcript NameFunction/comments
g9909.t1hypothetical protein
g9910.t1hypothetical protein

Sequence
6750 bases(100 bases per row)
TGTGGTTAAGGTGCCCGAGGAACTACTCGAGGTCACCAAACACGTTAGCCCACGTCTGCTTGGCCAGAGCAGGAGTCGACTTTATTCCTTTTCTTTAGAT
TCCAGAATGAGCTCGCTCGCTCACCCACTACTCAGGTTCGTACCCATACTCTCTGCTACCTGGGTTCACTACTGTCTCGGTAATTGTTGAAGTTGCTGCT
GTCGCTGGTCTGAACCCAGGTTAAGGCTGAGGCCTATTGAACTACGTGCTTGCACTGGATCATCATCTGTACTCGATACCTCACGAGACTTCATGGGAAT
CTCGTGACACTGGACCACTTCAAGATGCCCATACTTGGCGGCGCTACGCAACGCATTCGCCGGCATCCGCTCGCTCCGGTTCGCGTAGAGCCATTGCACA
ACGACCAAGTGGCCGTTGGCCGCTGCACTGCTCATGGCGTGTTTGGTGCATCCTTCTGGTCGGTTTTCGTGTAGGAAGCGCACAACGTCGAGGTGGCCCT
TCCCGGCAGCATAATCCATCGCCTCCGTGCTGCAAGGCTCACTGCGGTTGTCATGGATCCACTGCACCATATCTAGTCGACCACTGGCTGCTGCGTAGTT
CATGGCTCGATACGTGCAACCTTCACTGCGGTTCGCATGCAACCACTGCATAACAGGGAGATGGCCATGTTCCGCTGCCGTGTCCATGAGGAATCGTCCA
CAGCGACTCGATCCTTCGTGGCCTTCACCCCATGAAGTGCGTCCTGGGTAGCACTCGTTCAGCCATTCGAGGACGTGCACGAACCCTCGAATGACAGCGG
CCGCTGCCATGTACTGACCATTGGCCCAGTCCGGGTCGCGAGCTGCTGCATATTCCAGTGCTCGTCTCGGCAGCCCCAATCTGCACGCACGCCCAACTTT
CTTGCGCGATGAGAACGGATCTAGGTACTGGTCCACAAGCGTCACGGCGTGAGACAGCGATCCCACGTTGCGCTTCGAGAGACATTCGCGACAGACAACG
AGAGCTGTCGTGAGTTCTGGGAACTCCTGTCGCTTTGGGGTCTCTATCATCGCCACGTGTAAATCGAGAATGGAGCTACAGGCTGAAGTGCCATCTCGGT
GGAGTCAGCAAGAGGCTTCATCCGTTTTTGCAACCGATCGAAACGGACATCGCTGGATGGATTTGCCACACTGACGTTTACTGGCGAGATGTGGTGGCTC
AGCAATGTGCTGTCGCTGCTGAGGGTGAGCCGCACTCGCTCAAGTTCGTCAGGTACTCAAAGAACTCGGGCAGGTCGACAGTGACTCCATGTTGTGGGAG
ACAGATATGTTTGCTTAATGCGCTGGTAAGACGGCTTGGTAGGTTTGTCCACTGTAGTGAAAGCCACGCTTGTTAGTTCTGGATCTCGATAGGGTAATTG
TTACATGTATTCTATTGTGCACTTCTAGTTTGTCATGTTGCGGCCTAGGAGGGCGAAGGCGCTAGTCTAGATGGGTCTCGTGACCGCTCTCCGAGGCTCA
CGACATCTCGCAATGCTGCTACGATTTGTGAGCTTGCCGGGACGGCAAAGCGCCTGGCGAGATCATCACGGTCAGCGCACGCAGCAAGTCGCCCGGACGG
CAGTTCCACCACGTAGGCCAGTACGAAGGCAAGCATGGACCGCAGCCGAGACGCTGCAGTGTCATCGCTCAGGCTTTGTCCGATAGACTGCTCAGTCACT
TTGAGCACCGCCAAAAACTTGGCCACAAACTGAGTGAACACCTTCTCGACAGTTTCAATGCGTCCCTCCTTCATCGAGTGCAATTCGCACACAGCAAACA
CATCCAGTGACGATCCCAAAACCTTCAGGCAGCATGTGGTAGCTTGCCAGACGATATCCCACAGCACGAGACCAGTCATCTTCAACGGGGAAGCTGCTGT
ACAGCTCAAGTCACCAGCAGCGACGCACTCGGAGAAAGAGCTCGTGAACTCTGACAAGCACTGCAACAGTCCAGTCGTCTGGAGCTCCCACTCTGCAACA
CTGGGGATCTTGGACTCACTGCCGGCGTGCTTCGACATTGTAGCAATGCATCTCTTTAATGAGCGGTACCGCTGCTCTTCTTCGCGTAGCTGTGTCTCTC
CTTGGTTGGCAGCGCCAGTGACAGGTGCTACAATCGCAGCCGTGGCAGCTGTCGTAAGCAATGACGAAGAACGAAGAGCGTTCACCGTTGTCTTGGGACC
CCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTCTCAGAGCTCCGCGA
GTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGA
GACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTCGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGC
AGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGG
GCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCT
TGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGCCGGTGACTTCACTCCGGAAGTGGCTGAGTACCCATCGTTGTCATGCTTTGA
AGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGT
CCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTCGCTCACGCAGCTCTGGACAAACA
CTTGGCTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACGTTAGACGGCGGAAG
GAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTC
TCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAA
GCATCGTCAGATAGTCACACAGCCACGGGATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCG
CGCCACCTCTAGTGTGCTGATGCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGAGAGCTGGCGAATCGAGGACGTGACTTCCCATTGCGGC
GAGAAGCGCAGATACCCGAGGAATTTTGCCATCACCTGAGTCTTAACACCAGTTGTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCG
AATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCC
GTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGATTTCCATGGCG
AATTGTTGTTTCCCTTGCCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGTGACTTATTCAA
AGGCTTTTGGCTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTATCG
CTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAACTCCC
GCGCAAGCGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCGTC
CCGGACCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTCGC
ACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACCCGAGCACTTTCAGCCACTCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCGCT
CCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCATG
AAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCACCATCACTCCCCGGCTGCTCCTCATTG
CTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCCGT
ACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGTCCGACGACGAAGCTCCCTTCTTCACATTAATTGTCTTCTTGGCGGGACTCTCCTCTTCCTGATTAGA
CGGGGCCTCCCTCTTCTCCTGCTGGATATGGGTCTCCTGTCGTAAATGGGTCTCTTGGTTCGATGTCTTCTTCTGCGACACCGGAATTTTCTTCTTGGGT
CTCACCTGCATCACTCCTTCCTTAATCACCTGCTGTCCCCACACGTTGGTCCCGCCCATCCTCTTCTCCAGTAGCGACCTCTTGGCCCACGCGGGCGGGC
GCGTGCTCTCTGACGAACCCAAAGGAGGGAACGCGATGGTTGCAGGAACCGGACGCGCCACCGATGCGGTCGTTAACAGGGTCGTCGTGATCCTCCGCTT
CACGGGCTTCAATTGCGGGAACTCGTGCTCGAATGACTGCAACGCATCCATTTCGATCTCAGGTTTGGTCGTTGGACCAATTTCTGGTGCGGAATGGTCC
TCGGAGACCCGCGCGTTTGCGTGCAATTGCGTCTGCCCGTGCACAAAGTCCAGGAAAATGGGTACAAAGTCGTCCACGCGCACGCGCCCGAGCGGCAACT
GGACGGAGGCGCTTCTGGCGCTGGTGCGGGCCTCATAGGACGCCAGGGGCCGCGCGGGGTCGACGCAGTGGAATTGGCGCACACTGTGCTGGATGCCGCG
CAGCTCCACGTCCGAGAGACCGCCCACGGCCGCCCAGAGAGACGCGCCGTCCGATGAGCTCCGCGCCATTTTTTCGAAATTGGGCGGTTACGATTGGTGG
AAAAAATAGCGGGTGGACCTAAAACGAGCGCCCATTTTGACGACTTTTTTACCTGTATTTAGCAAGCTGGTTATGTTATTAGGGTTTGAGATCTTTATGC
GATGCAGGCATGATAATATTTATTGAGACGACAGGTTGCTCTATCTTACTTAGGAAGGCAAAATGGGCGATTCCGGTTACCTGGCCATTTACTCACCCAA
ATGCATGCAAGACCCACTTGCAGTTTAATCTCGATTTGATGTCCAAATTGTGCTTCCAGTGGGTATTGTGTGGAACGAAGGTACCGGTGTGCGAAGTCAT
GGAAAGGGTGAGCTGAACGCACTCAGGATCGATTCGAGTAGAGAACAGGCATTCGGGCTTGCTTCGGTCCGAATGCATGACCGAGTTGTCGCCCGGCATT
ATTATACTTCGAAGTACATGTATTATTGTGCTTTGCAATCGTTTTGGGAAAACGAGATAGGATTTGGTGGATTCAAACGTGCCATGTGGTTGATTTACGA
TAAACCAAGGTGCATAAAATCGGGCTGGCGTATATTTACGCTAAAACAGCCATTTTTGTGCTTTTGAAAGGGCAATAACGGCAGGGTTGCAACAATTCAG
TTGTCAGCCCCAGGCATCGTTAAATCTCACGCCAATCGAAAATGCGATCGACTGCATTACTAGGGCCATTCGTCATAGTCATGCATGTGCCTGCAGCACA
TGACAAGCTTTCAAGTGAGGGGAAACTGCAGAGTTCAATTCGATCCATCCTCCATGCAGATGGAGTTAGCTATTTGTATCGCTTGTAACACACTCTCACG
AGAACTGCTTGCCATATTTACCTCCTAAAAAGCCCGCTAAACAACTACAACGCACAATAGAAGTATTTTAAAATTTATTATTACCGTAATCGCATAGGCA
AAGACATCTCCACATCTTCTAGCACAGCATCTTCTTGAACGGTCGATAATGGCCGCTCATCTTTGATCGTTTGCGCTCGTTCGGAAGTCTTAATGTCATC
CAGAATTTCAACTTCTTCTTCCGGCTGAAGAGAGTCCGAAACTCGATCTTCTGCCGGGGGCTCAACCTTCACGACGTCACCCTCAGACGGCTCATCAGAC
GTCTCATCAGACTCTTGCGAGATGGAACCATTTTCGTCGTCCGAACCGGATTCCGATCCGGACCACTCGGAGTCTTCTTCCCCATCCGAAAGCACTTCCA
CATCACCGTCCTGATTCGCTTGGTGCGCCTCCTGAACGGCGGATCCAGAA