Description :
From Genome Similarity Track
Location :
Scaffold_496:17779- 20541
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.5Amino Acid-Polyamine-Organocation (APC) Family

Sequence
2762 bases(100 bases per row)
CCGGCCTCAGCAATCGCGAACAGTACTGGATGCGAAAGGTGGCAACACCACTGGGCGACTCGTGCCGAAGTACCGCAACGCTGCGGGCGGCGAGTTCGTC
GGTGGCATGAACGTAGCAAAGTCGCCTCCCGAAGCAGCCTCTTGCTGCAGCAGCTCGTTCCACAGTTCGTCCTTGGCGAACTGCAACGCTTGTTCTTCTG
GCAGATCGTCGATCTCAACCTGCACCAACGTGGCATCGGCTCGGGGCTTGAGAGCTTCGAGAACGGCGCGCTTCTTATCGTAGACGTAGTCGAGCAGCTG
CAGACTGCGCATGTGTTCGAGGTGCTCCTTCTCAATGAACTGGAGCTTCTTCTTGTCGGACACGGTCTTGGCCGTGGCTTTAGCTGCGAGAATCTCTGGT
GGTTGCTGGAACACGGTGCTCGTGGACGCCGACAACGCGAACGGCGGCTTGTTGTTGCGGAGCATCTCCTGCCGCATGTCCAAGAGCTCGCGCGTGAGCT
GGAGCTCCTCTTTGGTGATCGCCTTCATGGCCGACACTTGTTGCATTTGCTGGCGCGTCTTGTCCTCCGCGAGCGCTTGGCAATGTGTCTTGTGGAGACG
GTTTAGCAGCTTTCGGTCGTCAACTCGTGCAACCTGGCGATCCAGACTCGCGTCGCGAATGTCACGGAGCTCCTCGTTCTGCACGTGCCGCGATATCATC
GCCACACTCGCGGAGAAAGCGCGAGCCATCTCGGTGTTCTCAAGTCGTTTCTGTTTGGCACGAAGCTGCTTCTGTCGCTGCTGTCGCTGTCGGTCGCGAA
CTTCGCTGATGAGCGCTGGAGCTGAAGCACTTGACGTAAGATTTGGTCGAGGCGGCTCCTACATTTACAGCAATCGAGTGTTTGGTCAGCATATCCAGCT
ATGACGTCGAAGATATCAGTCAAACGTACGGGCGGAGGGTTCCGCGCATAGTCGTGGTAGGAGAAAGCGGCTGCGGCGTCATTACCCTCGGCCATCAGGT
TGAACGGATGACGAGCACGCTGGTGTAAGGACTCTGGTGCTGGCGAGCAGGAGTTTGAGTCGATTGTCCGAATTCGCGTAAGTCGAGGCTTCATGTGCTC
AATCATGAAATCCTCAGTGAACCACAGTCGACAGGCCTGAACGAACGCAGTCGCAGGAATCGTCACGGCAGCAGCGGGCAGTGACTGTTCCCATTGTCGG
TACATGGTGTCGCTGACTGGCAATTCGAACACATCGAGCAGCTCCTTCACTCGAGACAGCTTGATGCACTTTTGATGAACGATTGCAGAATCGAAAGTCA
GCAGCATCTGCTCGCAGGTTGCAAGGAACTCGAGCTGCTTCCGTGCCCATTTGCCGTCTCCTTGAGCTTGGAAGGCGGATCGTGACTCTGGATTTGCTGT
CTCGCTGTCATCTGTGAGGGTCGCTCGACTTGCCGCCTGGTTTCGAGCGAGCATTCGGTTTGCCAGATCCGAGCTGCCGGCCATTTTCCGCAGCGTCTTG
ATCGCCGCCGTCGATTGCGGCTGCACGAGCGGAACTGCTTGCCGATACAAACCGAGCGACTCTAGTATATCGTTTGCACCATCACAGCTGCTGGTCGCGC
TGGTGTTGCCATCATTATAGCTGCCGATTTGCCCAGTCGTCTTGCTGTGACGGAGCACTTGAATGCTCTCGCGTTGCAGCTGGTCATTTGAGCAAAGTTC
CATACCCTCCGCCGCACCATGCGGATGGCTTTGTTGCTATTGTGGCGCTCGCACCATCGCCAGGCGCTGAAAATAGCCGCGTTTTAGCCACACAACACCA
GAATGACGCGGGAACGCGAATTCACAGTGAGCAAAAATCTCAGTTCTATTGTGCCCTGATTCACTCTAGCAGATCGCACAACTTTGTACACATTCTCTCC
ACCTACAGAAGCGGAGCCAGCAAGTCGGCATCGTTCAGGACGCTGTGGCGAATGCCATACAGCAGATACACAGACAAGCCGCAGAGCAGCCAGATTCCGA
CTCCGATCCTGAATCAATCAGCCCATGTCGTTAGTCGGTGGCTGCTACCCCCTCGCATACAAAACTGCACCATTCACGCACCATCCAGCGCCAGGAATGC
TAGCCATCATGTAAATGTTGGAAATGATGCCGAGGCACGGCACGAGCGGCACCAGTGGACACTGGAATGAGCTGGTAAGCGGGCTAAAGGCACACAGTCA
GGAAGTCATAGTTAGATGCTAGTTTCAGCGTGGCCGACGAGTTCGGCAAACATACCTGAGCTTTCCAAGCCGATGAATAACAACGAACGCGGCGATGGTG
ACGATGATCAGCGCCGATTGGATTCCCCAATGCAAGTCGAAGACGAGCGACAACGACAGCACGAGGCACGCAGCGACAAACACGAGAACGCGATGAACCA
CTCCGGCGCCACTGAGCGGAGGCTTCATCCGCAGCAACAGCACGCCGGCGTTGACGAACGTGAAGACCATAAGCGTCCCGCACGAGATGACGTTGGCGAG
GAAGTCGAGGTCGAAGATAAACGAGACTAACCCCACTAGGATTCCAGTGAAGATGGTGCTCGCCACTGGCACGTGGGTCTTCTTGCTGAGCCGTCCAAAC
AACTCGGGAAGCAGACCATCCTTGGCCATTTGGTAGAAGATGCGCGGCTGTCCCATCAGACAGGTGAATGCCGCGGTCGTGAGACCAAAGATGGAGCCGA
AAGAGACGATTCGTCCGGCCCACGGAACGTGGTGGTAGATGAACGCGTTGACGAGCGGCACA