Description :
From Genome Similarity Track
Location :
Scaffold_48:177704- 180961
Sequence
3257 bases(100 bases per row)
GGGCAACGGACGCGGGTCCGACGCTGTTGCGGAGTCACAACAGCGTAGCGGACCGTAAAAAAACGGTCGAGGTCAGTAGGGGCGGAGTGCCCTACTGATC
CAGCAACCTCAAGAGAATTTTCAAACCTCTTGATGAAAGTTGCTCCAGACTCACAATCGTTGTGTGTGTCTGCTTGGTGACGAGATACCCCTCATCACCT
TGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCATCGAATTTTTTTTTCGTCGCCAGTCGCTAGAGGATGGTAGGCTC
AAGTTTGTTGAGCGCGACATCCCTCCGACGAGGATGACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGAAGAAGCGCGTAGTGGGACTTCATTACA
CGCTAGAAGATTTGTAGTACGATGATGATTTCATCGTACTTGATTTGGATGACAAGTTTGATGTCATCCTAGGTTTGCCTTGGTTCAGAAAGTATGAGCC
AAGGGTCAGCTGGAAGCATCGTACCGTGACGATGCCTGCCACTTGTTCATCAGATGGCTATCTGGTGATCGTATTGGAGCGTCCACAAGCGTGTGGATGT
ACTGCGAGCGAGTGCGATGGCCTCACTTGCGTAAAGATCGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGAAAGCTGCCG
GCGGCTGTGCGGATGCACAGGCCGCGCCGAAGGTCCACCACACAAAGAAGTCGAGTGGATGGGGACATTGGTGTAAGCCTAGTGGACGACATCCAAGGAA
GAATAAACCAGTTACCCACACAGGGAAACACGATGATCCTAGATCGACTGGAGAGTCGATCGTAGAGGACCTATCTGATCGCGCCTCCGAAGTTGAATTC
GGAGATCAATCAATTGCCAACGCTAGAATCGAAACGGTTCTTGCAAGATCTGCATTGTGGGAAGGTCAAGCAGATATGTGTACTCGTCGGAGACGACGAG
CACGTGGCTGACATTCGGTCGGCAGTAGTATTTGCCGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGAAGAAAGTGTCCTCGATGAGAAGACTCGGA
TTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATACAAGAATTTGATCGAATTTAAGGACGTGTTCCCTGAATCCGTACCATG
CAAATTGCCTAAGGATAAGGCACTCAACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTATCATGAAGCAGCGGCCACTGCCTCGTGAAAAAGTTC
TTGCGATCGACAAGTTCTTTGCCGATCGCTGAGCTGCGGAACATGTGAGGGAGGAAACTTCCCCTCACCGCTCTCCGAACTTATGTGTGCTCAAGGCCAC
AGGCGGATGGCGGATAGTGCACGCATTCAACAAGTTGATCGTTGCAACGGTACCGGCTCAAACGCCGATACCGAGGAAGAACGTAATAATTAATGGTATG
TCAAAAAGTACCATCTTTTCGTCCGTGGATCTGATGGATGGCTTCTATCAGGTCCTAATGCGTGAACGGGACATCCCGTACACAGCAGTAAGCAACCCGT
GCGGCATGGGTGGGAGCGGCTAGTAATGCCACAAGGGCTTAGTAATGCCCGTGCCACCTTCAACAGATTTGTTACAGATCTGTTGAAACCGTGCGAGACT
TCGCACCGAGTTACTTTGACGATGTATTCGTTCACAGCCGGGCTATGGGCGGAAAGACGAAAGTAGAGGTATATAGAACTTACGATCGCCAGGTTCTTAC
ACTTATGCGAGAGCTAAGTTGTACGCCAACCTCAAGAAGTGCATATTCGCTGCAAGCAAAATACCACTTCTTGGGCGCATCGTTGGAAGAACGGCGTACG
CCCTGATAAGGAAGCGATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGATGTCAACAAACTTTAAGATTTCATTGGGAAAGCAGCGTACTTGCACAAA
TACCCGCACATCTATGGCTCTCTATTCGCGGAGTGTAGTTTCTCCGTCGATTGATACCCAGGACGACTTAAAGTCGTCGCTGGTGAGCTTTCGCGCCGGC
CAAGTGATCCAACAGTGAGGATGAGCTCACTGTTGCAACACTCGTAGCAAGTGTTCCGTCGTCAACACTGCTTGACGACGTGAAGAAATCATCCGCGAAA
GATAAGGATCTTCTGCAATTGATGGATCATTTGGTGAATCCATCCCGGCAATCATTAAAGAGATTACCCGCTTTGTACCAATCCTCGTCGTATCTGTACA
CAACACGCAACGGGTTGCTATACTATACAGCCGTTGCCGGCAACACCTCTCGTGTCGTCATTCCCACTCATAATGATTTTGCACATCATGTATGAGTGTC
ACGATGCACCAACAGGTGAGCATCGTGGTAGAGAAAAGACCTACCTTACGGTAAGTCGAGACTTTAACTGGCCCCGCCAGTATAAGCTCGTGCGCAAGTA
AGTTCGTGCTTGCGAGTTCTTTCAATGGGTGAAGCCTAGTCCTTCATCTCTTGCACCGTTCCAGCCTCTGCCTGTTTCGGCAGAGTGCTGGCAGTCCGTG
TCAATGGACTTCGCCTTCGTAATCTTCGAAGACGACCACAGGTTTCTTGTGTTTGTTGACCGATTCAGCAAGATGTTACATCTTGTTGCTGTACCGGAGT
CAATAAAAGCCGAGGGCTGTGCTCGTGTATTTACTGACACGTCTTTTTGACTCCACGGTTCACCCGTGGACTGATCTCGAATATAGATCCGCGGTTCACG
GTGGAGTTTGGCTATCCGTGTTCCATACTCTTGGAACAGAGTCGACGATGCCAACTTCTAACCATCTTAGAGTAGATGGTCAGACGGATCGGTATTCGTG
TCCCACAAAAGTGGGGGACGTCACTGTCTGGCAGGACAGTGCTGGTGAACTCCATCATACCAGATCCCGAAGGCTTGACTTCCTCCCCCACCGGGGGTCG
AACCAGTGACCTCTGGGATGACGCTGCCACGCCTTCCTGAGCTACTGTGCGTATGTACAATCGCCGGGTTACTTCGATAATAACCCACTCATTAACGATT
TGGAATGGATCCTTGCTGATAGCAGACAATTGCAATCAACATCTCGGTGCATGTGTCGCGACGCATACACAGGCTTGCGCCATCCATGTATCCAGGCCTT
ATTAGAGTGTGACTCTGGTTCGAGGGGGGAGGGACTCGCTCGAGCAAAACCGTTCTG