Description :
From Genome Similarity Track
Location :
Scaffold_525:1777- 4813
Transcript NameFunction/comments
Phypl_g9130hypothetical protein

Sequence
3036 bases(100 bases per row)
AATGCCTCCTCGGCTTAAACCCCACCACAGGCTACAGATATGCTGAGCGAGAGAAATTCAGTACGACGAACGTGCTCGAGAAAGCAAACACTTCAATTGC
TCGTAAGTTGAGCATCTTGAGGTTTACCCGTGAGGTTTGTGAGGATATGATGCTTGAACAGTGAATTGCATCGTACGTGGTGTGGCACTTGCGTGGACTT
GTCCCCGACGACGTAGAACATCAAATGAAGGACTATCGAGGTGTTCTGGCGGAGAAAACCACCGAGTTGAGTCACAGCTAATTTTGTTGAGTTTGGTGGT
GGTTGATCTTGTTGAACGCCTGGTCTTAAGCAAAGGGCTTTTGCGGACGCCTTGAATTTAGAATTTTGCGGACGCCTTTAATTTAGCATAGGATGCCTTC
TAGTTCTCTTGTAAAAACAGTTTTCCGTACCGCTCCGTACGCTGCGCTAATCTGCGCTACATGGATAAACAACCATTGGAGGTGTTCATATTTTACTGAC
TTGCGATTTTCTCCAGCTTCCTCTGGTTGGAGCAGAAACTTAGTTTGCTGATCCTaagaaaaagaaaacaaTGTATATTGGTTGATATTGCAGGGTTTGA
GCACTGGAAAACGTTTGGAACAATTGTTATTTTGGAAGAATCAGTGCGATTTCGTGCTGATCGTGAATGGGGAAAAGGATGTagagcagctcgacgtgga
ATATGGACGGAGGCGTTTATCGATATTATTAGCAGCAGTGTAGCGCTTGAAATGCCAACTGAGAGTACAGGGCTAAAATTTGAGAGAGGTAACGCAGCAA
CAGTGCGTTTTTGCAAGTCCTGAAAATACGGCACGAGTCGCAATAAAGAATTCATTCATAGTAAGAGTAGCAACGAAACTGACAGGAAACAACTTCCCCA
TTCGAGTAGTAGCTAAGTTTTAAGGGGACGCTGCGGTATCTCAGTCGGTCAGAAATTGATATGATGATGAATCTTCCGGATTCGAAAATTGGGTGTATGG
TTATTGATTTGACGATACCTAGTACATATGTATGCCAACTCAAATCACACAAAACGTTAGACCAGCTAAACGCGTGGCGAATGGAACTATGGGAGTGTTA
GTAAACGTTATTTTCGAGATATCAACTATATtagaggggggggggtcataATTGATTTAtggcaaaaaaaaatatgTCCAACATTTCTTGAGAATATGTC
CGGCCCACGATGCAAATAGGTGGGGGGGGCATATTTAACTTACGGTAAAAACAAAATATGTCCGACATTTCTTGAGAATACGTCCGGCCCACAACGCAAA
TATGTCGCACCGAAATTCAAAAACGCGCGGTGATATTTGTTGAGATTGGTCGAGCTGTGTGTAAAGATAGGAGGTGGAGGATGTTTGGACCCAGGAGAGG
GGTTTAACCTCCCAGCCTCGTTACTATAGTTACGAAACCTACGAGTCGATAGGATCCTCGGGCCTAGTGCTCCATGAATTCCACTTCCTCATTTCCTCTA
TGCATCTCAACAATATGTTGGGCGGTAACCACGCTTAATATATATCGTAgtcgtgaacttcttcttAGGTAGTCCACCGACGGCGCATGCTGTCTTCCGA
AAGCTGCGGCAAATTTGGTTTGTGGTGCGGAAGAGGTGGTgcgacagcgtcttgaacACGATAGGCTTCGTCATCGTGGCTCCAAATGTCTTCCCCGAGC
CATCATCCGAAAATTGGCCGGTATCTCCATCCAGCCAACGATTATGCCATAGTCGTCGCGTGCAAGTTGAACCTttgtcacttcaacgtcggcttcttcc
tcacTCAGATCATGATCTGTACAAACTGCAAAGTCGCATGGTCAGAGCAAGGTACCGGGACGAGTGGTGCACTAGCTAAATATATCTTCGTTGCAAGCAG
ACAGTACGGAAATTGAGGGAGGTGAGTGTGGGTAAAGATCATTCACACTGCAATCGCAAGGTAGAAGATTGCAGTTGGAGATCGCAATCTGCAGACAATA
TCGAGAATCCAAACACCCCGAGAACTAATTATAATATTCACTTGAAATGGTATTTCAAAATATTCTGCTCAGACCAGAATCGCTTTGACTCATTGCAAGA
AACGGAGGAAACCTCGGAGCCAGAGGACTTGCTCGCAGGGCGGGATCGTTATCATCGGCTGCAGACCCCGAGCCGACCAAAAaagcggccagcaccttcc
tGTAGGCATCGCCCACGAACAGTGGCTGATAGAAGCGGCACCGCGGCAACTTTCAGGTACTCTGACTATGATCTTAAGTCTGACTAAGAGCATCGTATTC
CCTCCAACTCGCGATAGAAGCAGAAATGCCAGCACAGGCGTCTGGCACGACCGTCCGTGCTTCATGGGACACGGACATGGACGGCTTCCTCATTGACGCT
ATGATCGATCAAGCCAAAGCTGGTAACGTGCCGACTCTGGATTCAAGAAAGAAGCCTGGGTTGCCGTACACGAGTCCATCAACGAGGAGTTCAACAAAAG
CCTCACAATCCAGCACATCAAGACACGTGTCCAAACAGACAGACCTGTAGTCGCAAACAAGCTGTTTACATTTGCTTACACTAATATTTCACTTACACGC
GTTTATCTGCAGTTAAAAAACAAGTATACCACTAGATCCGCCATGTTACAGGCTTCTGGCTTTGGATGGGACGTCAGCCGCAATGTTGTTCTtgtgcacg
acgacgtctggCAGCGGTACATGAAGGTAAGAACCCTGCGGAGCTCTTGGTAATGATATAACTATCTGACTGTTCATTTTTCTTCGTGCCTGAACTTATA
TAGGAGCCCCCGAAGGCCACCGACTACCGCAACATTGCTGTGCCGTATTACGATCAACTTGTGGACCTATGTGAGGGTATATATGCGACTGGAGACTACG
CTCTAAGCTCAGATGAACCCTGCCCGAGCGACTTCGTCGTTGACCTTaatgctgctgagcaaggcGCCTCTGTGACTCCTGTAGCTCGACCGGATGATAC
GCCAACGTCGGAAGTTCCGAGCCGCGTGCCTGGAAC