Description :
From Genome Similarity Track
Location :
Scaffold_281:1777- 3852
Transcript NameFunction/comments
Phyke_g7890hypothetical protein PHYSODRAFT_512708

Sequence
2075 bases(100 bases per row)
CAATGGCATCTGCGTTCGCTTTGAGTCCAATCCAGCAACCGCGAGCCAAATTCGATGGCAGTGGATCGGCCGGTGCAAGTTCCTCCAGTACAGCTCAAAG
ACGACGAAAAGAGACTGTCAATGAGCGGGTGGAGCACATCCTGAGAGGGGCGATGCGCGAtgccgaggaagaagctctaCAGGAGCGTGAAGGTAGCCCC
GAGACACGTGGGCGTGCACTGCAGCGGTCTCGCCAATTGGCGTCGCTGTACGACATCTCGACTGAGAACAAATTTCTGCGTTCGCGTGCCAAGCGGAGTG
CGTTAATCGAGCTTGAACTGGAAAAAGCCAAACGATCCTCTGAGATGTCCGAGCTTTGCGAGAACCCGAGAACAGGTTCAGATTGCGTAGTAAGTTCGAC
CGAAAAAGAGGACGAAAGCGATGGAAGTGACGATGAGAAGTCGTCTGTGGGGCGTATGGTGCTTACTTCGCCCATCAAAGCGATGGCGGGCTGGAACAGT
ACTATCGACTTGACGTCTCGATCACCTGTAGTTTCACCTGTAAAGCAAGCGAGACCTTGGTACAACTCCAGCCCCAATGCGTCGCTAAAGCAACAGGTAG
CACTAGGCATCACGCTGGACGCCAAGTTACGTCGCTATGGAGGTCGTGGCACAGCCAAGCTTGTGCGATCTGCAGAAATACTGGAGCCGCTTTCTACCAA
CCACCCGGTTGTCGCCGTTGATGAATTTGTACCAGGTCTGAGCGGTTCGCCTTCACTCTGGCCACCGGAAACTTTTCACCCAAGTGGATCCCGTCTATCG
GTCACGTTGACACGTTGTCCATCGTCTCCAATCGCGACTGCTGTCGAGGTACCCGTGGCTCTTGACGAAAAGAATAATTTAAAAGCACAGTGTCATCTTC
ATACTAAGACACATGAGGCTTTGCAGCAGAGTGCAGTGCAGAAACTCCAAGTTGCATATAAACAAGAGACAGAGGATGCACGTAAGCAGCGCATCGAAAA
CCAGCAAGACATGTCCGAATGGCAGAGCCGCACACTGCACTTCAGTCCACCTCCTGAGCTCGTGGCAcatcgacagcagcagcaagacgacCCACAGCTC
CGCCACCGACGTACTAAGAACACGGCAATAGTGCAGACACCAGGATATTCGCCTGAGAAGCAGCGCGGCAGGGAGTCGCACGACTTGTATAAGAAGCGGT
TCGCACTTCGATGGCGCGCGTTTTCCCATTTACTTGATGCCATGCGACGTACACCATGTCGACGACCGGTGCTGAAGGACATGGAAAAGCTATTTGCATT
AGCTCGGGAGCTCTGTGCACTAAATGCTCTGGGATCTTGTATGCTTTCACGCACTCAGTTCATGCTGCTTATCACGAGGGAGTTTCCTTTGTGCGACGTG
AAGTATGTGAATCGCCTGTTCTCGTCTTACGACTGGGAACTCCGTGACTCACTCGACGCTCGCTTAGTTCTCGGCACCATTCGGGCAATGCGCGTGCAGC
AAGGCGAGCCAGTCGAGATTATATGCACTTCACTACGGGACTTTGACGACAGTACGGGTGTGAACAGCGGTGGTGCAGATGACAACAAGTCTCTGGTGTC
GACTGGTGTTAGTTTGGCCAAGGCATTGTCCCTGTGTTGCGccaccgacgacgaagagaaggacatGGCGACCAGGGCTGATGCTATCTGGACCAAGGTT
CTCGCCTGGCAGCGACAAGTTTTGTCGAAGCGTCTGAATGGGGGCAGTGGGAACGCATTTGGGACGTGGAGTAACACACGCAGCAATATACCGTCACGGG
CAGGTGTCACTGAAAGCTTTGAGGACTCTAGCCGGAaaggagatcaagaagcgGTTCGTGATGATGACGGTGATAGCAGAACtgtcgacgaagaggacAA
TATGGAGAAGCTCACTGACCTCGTTCGGTTGGTAGATGAGTCACGAGTGTCGGTGCGGCGCGTGAGAACAGCGCTTAAGCGAGAGAAGCAAGCCTTGGAT
CTCTTTACTCAACAACTATTGCAGCGTCGCCATGAGTGCATGGTCGCAGCAATGACAGACTCTCCTCGACAGTGA