Description :
From Genome Similarity Track
Location :
Scaffold_48:177698- 180978
Sequence
3280 bases(100 bases per row)
CAAGAAGGGCAACGGACGCGGGTCCGACGCTGTTGCGGAGTCACAACAGCGTAGCGGACCGTAAAAAAACGGTCGAGGTCAGTAGGGGCGGAGTGCCCTA
CTGATCCAGCAACCTCAAGAGAATTTTCAAACCTCTTGATGAAAGTTGCTCCAGACTCACAATCGTTGTGTGTGTCTGCTTGGTGACGAGATACCCCTCA
TCACCTTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCATCGAATTTTTTTTTCGTCGCCAGTCGCTAGAGGATGGT
AGGCTCAAGTTTGTTGAGCGCGACATCCCTCCGACGAGGATGACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGAAGAAGCGCGTAGTGGGACTTC
ATTACACGCTAGAAGATTTGTAGTACGATGATGATTTCATCGTACTTGATTTGGATGACAAGTTTGATGTCATCCTAGGTTTGCCTTGGTTCAGAAAGTA
TGAGCCAAGGGTCAGCTGGAAGCATCGTACCGTGACGATGCCTGCCACTTGTTCATCAGATGGCTATCTGGTGATCGTATTGGAGCGTCCACAAGCGTGT
GGATGTACTGCGAGCGAGTGCGATGGCCTCACTTGCGTAAAGATCGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGAAAG
CTGCCGGCGGCTGTGCGGATGCACAGGCCGCGCCGAAGGTCCACCACACAAAGAAGTCGAGTGGATGGGGACATTGGTGTAAGCCTAGTGGACGACATCC
AAGGAAGAATAAACCAGTTACCCACACAGGGAAACACGATGATCCTAGATCGACTGGAGAGTCGATCGTAGAGGACCTATCTGATCGCGCCTCCGAAGTT
GAATTCGGAGATCAATCAATTGCCAACGCTAGAATCGAAACGGTTCTTGCAAGATCTGCATTGTGGGAAGGTCAAGCAGATATGTGTACTCGTCGGAGAC
GACGAGCACGTGGCTGACATTCGGTCGGCAGTAGTATTTGCCGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGAAGAAAGTGTCCTCGATGAGAAGA
CTCGGATTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATACAAGAATTTGATCGAATTTAAGGACGTGTTCCCTGAATCCGT
ACCATGCAAATTGCCTAAGGATAAGGCACTCAACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTATCATGAAGCAGCGGCCACTGCCTCGTGAAA
AAGTTCTTGCGATCGACAAGTTCTTTGCCGATCGCTGAGCTGCGGAACATGTGAGGGAGGAAACTTCCCCTCACCGCTCTCCGAACTTATGTGTGCTCAA
GGCCACAGGCGGATGGCGGATAGTGCACGCATTCAACAAGTTGATCGTTGCAACGGTACCGGCTCAAACGCCGATACCGAGGAAGAACGTAATAATTAAT
GGTATGTCAAAAAGTACCATCTTTTCGTCCGTGGATCTGATGGATGGCTTCTATCAGGTCCTAATGCGTGAACGGGACATCCCGTACACAGCAGTAAGCA
ACCCGTGCGGCATGGGTGGGAGCGGCTAGTAATGCCACAAGGGCTTAGTAATGCCCGTGCCACCTTCAACAGATTTGTTACAGATCTGTTGAAACCGTGC
GAGACTTCGCACCGAGTTACTTTGACGATGTATTCGTTCACAGCCGGGCTATGGGCGGAAAGACGAAAGTAGAGGTATATAGAACTTACGATCGCCAGGT
TCTTACACTTATGCGAGAGCTAAGTTGTACGCCAACCTCAAGAAGTGCATATTCGCTGCAAGCAAAATACCACTTCTTGGGCGCATCGTTGGAAGAACGG
CGTACGCCCTGATAAGGAAGCGATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGATGTCAACAAACTTTAAGATTTCATTGGGAAAGCAGCGTACTTG
CACAAATACCCGCACATCTATGGCTCTCTATTCGCGGAGTGTAGTTTCTCCGTCGATTGATACCCAGGACGACTTAAAGTCGTCGCTGGTGAGCTTTCGC
GCCGGCCAAGTGATCCAACAGTGAGGATGAGCTCACTGTTGCAACACTCGTAGCAAGTGTTCCGTCGTCAACACTGCTTGACGACGTGAAGAAATCATCC
GCGAAAGATAAGGATCTTCTGCAATTGATGGATCATTTGGTGAATCCATCCCGGCAATCATTAAAGAGATTACCCGCTTTGTACCAATCCTCGTCGTATC
TGTACACAACACGCAACGGGTTGCTATACTATACAGCCGTTGCCGGCAACACCTCTCGTGTCGTCATTCCCACTCATAATGATTTTGCACATCATGTATG
AGTGTCACGATGCACCAACAGGTGAGCATCGTGGTAGAGAAAAGACCTACCTTACGGTAAGTCGAGACTTTAACTGGCCCCGCCAGTATAAGCTCGTGCG
CAAGTAAGTTCGTGCTTGCGAGTTCTTTCAATGGGTGAAGCCTAGTCCTTCATCTCTTGCACCGTTCCAGCCTCTGCCTGTTTCGGCAGAGTGCTGGCAG
TCCGTGTCAATGGACTTCGCCTTCGTAATCTTCGAAGACGACCACAGGTTTCTTGTGTTTGTTGACCGATTCAGCAAGATGTTACATCTTGTTGCTGTAC
CGGAGTCAATAAAAGCCGAGGGCTGTGCTCGTGTATTTACTGACACGTCTTTTTGACTCCACGGTTCACCCGTGGACTGATCTCGAATATAGATCCGCGG
TTCACGGTGGAGTTTGGCTATCCGTGTTCCATACTCTTGGAACAGAGTCGACGATGCCAACTTCTAACCATCTTAGAGTAGATGGTCAGACGGATCGGTA
TTCGTGTCCCACAAAAGTGGGGGACGTCACTGTCTGGCAGGACAGTGCTGGTGAACTCCATCATACCAGATCCCGAAGGCTTGACTTCCTCCCCCACCGG
GGGTCGAACCAGTGACCTCTGGGATGACGCTGCCACGCCTTCCTGAGCTACTGTGCGTATGTACAATCGCCGGGTTACTTCGATAATAACCCACTCATTA
ACGATTTGGAATGGATCCTTGCTGATAGCAGACAATTGCAATCAACATCTCGGTGCATGTGTCGCGACGCATACACAGGCTTGCGCCATCCATGTATCCA
GGCCTTATTAGAGTGTGACTCTGGTTCGAGGGGGGAGGGACTCGCTCGAGCAAAACCGTTCTGGCTCTTGCTCATCACGT