Description :
From Genome Similarity Track
Location :
Scaffold_43:177690- 181550
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012572Similar to Abca1: ATP-binding cassette sub-family A member 1 (Mus musculus)

Sequence
3860 bases(100 bases per row)
TGTGAATCCAAACTTTGAGTCTGTTAGCGGTGAGCTTCGTGAACAAGAGCGCAATGGGAACGTGCTCTCTGTCCAGCAACTTCGTAAAGTGTTTCCCGTG
CCAGGTGGCGAGAAAGTCGCCGTGAAAGGCGTTGACTTAGTCATGTACAGAGACCAGATCACGTGTTTGCTCGGGCACAACGGCGCAGGCAAGACAACCT
TGATCTCGATGCTCACGGGAATGACACCAGCAAGCAGCGGTAACGCCACGTTCCGAGGCTTATCCTTGAACGACGACATGGATGCGATTCGCGAGTCGCT
CGGGATTTGCTTCCAGCACGATGTGCTTTTCGGCGAGTTGACCGTCCAAGAGCATTTGCTTATCTTCGGTCAGATCAAAGGATACGTGGACGAAGAGTTA
ATGGCCATCGTCGAGAACCAGATCCGGGAGGTTGGACTAACGGAGAAGCGTCACGTGAAGTCCTGCGAGCTCTCTGGTGGTATGAAGCGGAAATTGTCGG
TTGCGATCTCGCTGCTGGGTGACAGTTCACTTGTGTTTTTGGACGAACCAACGTCAGGTATGGACCCGTACAGTCGACGCAGTACGTGGGAGATCTTGCT
CAACAACCGCAATGGCCGTGTGATGGTGTTGACGACGCATTTTATGGATGAGGCCGACATATTGGGAGACCGCATTGCGATCATGGCTGAAGGTCAGTTG
CGCTGCTGCGGATCATCGCTGTTTTTGAAAAATCGATTCGGCGCCGGGTACAACTTGACACTGGTCAAGGACGATGCTGGCTGTGACGACAACCAACTGA
TCGCATTCATCCAGTTGTACGTGCCAGCAGCGCAGGTTCTGAGTAATGTCGGCAGCGAAATCGCGTTCCAACTTCCTCTCGCGAGTTCATCGGAATTCGC
GTCGATGTTCGCGGAAATGGATCAGCAATTAGCACGTTTGGGTCTCTTATCGTACGGCGTGTCAGTGACGACATTAGAGGAAGTGTTCATCAAGGTCGCC
GAGGCTGATGACGAAGACAACCAGCACACACTTGGCAAACAAGCGCGGAACCCTGGCCCAAAGGAAAATGCGCCGACTGGGTTTGTGGTCGAAGACGTTC
CCGTCGCCAGCGGCGGTGAGCCACAGGGACTGTTCATGGTGCATCTCAAGGCTCTATTGCTCAAGCGGTTCCGCGTTGCCAAGCGCGACAAAAAGATGAT
GATCTACAGCATGTTTCTTCCAGTGCTTCTCCTCTTTCTTGGTCTCGAACTGCAATCGCTCGCGTCGATCACCAAGAGCGATCCAAAGCTAGCGTTGACC
ACGGATGCGCTTCCCGATACTCAGATGAGTCCTACGCCGTACTACTGCCAAGCTGATACGGGCAACAACAAATGGTGCAGCAGTGTAATGGACGCGACGA
TGTTCACGGGCGCTGCGCCATCACAAATCTCTACTGCTGTGATCCCGCAGCCAGCGTTTGAGTCAAGCTCGCCGACTGTGTTTGACGTCAAGTACACCAA
CCCAACGATCAACCAAAGTGATGCGACAGGATACGAGCTTCGGCTCGGACAAGAAGTCTTCAATACAGCGTACGGCATCAATCAAGCCGCCGTCACGGGT
CAATTCGGCGCGTACTTGGTGCATGGTGATAGCAGCAAAAACCTCTTCAGCTATAACCTCCTCGTCAACACGACCGCTATGCACAGCGCTGCGATCTTCA
AAGCGCTAATGGACCAAGCCATTTACCGCTTCTTCGCAGCCAACACAAGCTCCCCAGCAGCTGGGGACGATGCCATCGACCTCAAGGTAAACAGTCATCC
ACTCCCGCTGTCGGCGTCGTCCAAGGCGCTGTTTGGTTCGCTGTTGGCGTTCTCGTCGTGTATCCTGATCGTGGTCGCATTCACGTACTTTCCCGCGTCA
ATCGTCGTGTTCTTGGTGAAAGAGCGGCAAGCTGAGCACAATGCCAAGCACCAGCAGTTGGTCTCGGGCGTTTCGCTGAGTGCGTTTTGGCTCTCGAATT
ATATCTGGGATCTCATGATCTACGCGGTTCCGTTCACAGCTGCAATTATCATGATCAAGGCATTCGATATCTCGTCTATGACCGGCAGCAGCGATTGCCA
GGCGTGCACGTCATCGACGTTCCCTGCCGTCATCCTGCTGTTCTTCCTCTTTGGCCTCGCGATTTGTCCGTTCACGTACTGCATGTCGTACTTGTTCAAG
GACCACGCGTCGTCGCAGACGTACACGATTATGATCAACTTTGTCATCGGCGTGGTGCTCTTGGTGGCGTCGTTCATCATGGATATCGTCGACTCGACAG
AATCGGTTAACGACGTCCTCGTGTTCTTCTGGCGATTTTCTCCACTGTTTAGCTTGGGTCATGGCTTGTTGAATCTAGTGCTGGCCGATTTGGAATCTAC
ACTTGGAAGCACGGGCGAACAGAAAGGCCCCTTCAGCACAGATGTCATGGGCTTTGAGATCATGTACCTCTTCGTGATGACGCTCGTGTTTGGTTCACTT
GCCGTGGGCATCGACTACGCGATGACGTTTCCCAGTGTCAAGCAGATGACGGCGCCCGACCACAGCCAAGACGACGAGAACCACGTGGACGATATCGATG
TCCAGAAGGAAGCACAGCGAGTCGCATCCGGTGGCGCCGACAAGGACATGATCAAGTTGCACAACTTGCGCAAGGTGTACAAAGGTGGGAAGGCGGCAGT
GCGCAACCTGACCTTTGGCTTGAAGCGTGGCGAATGCTTTGGTTTCCTCGGTATTAACGGCGCGGGGAAGACGACGACGATGAAGATGCTTACTGGGGAC
GTCGTGCCTTCAAGCGGCACTGCCACACTTTGCGGCTTTGATATCTTGACCCAACAGCTCGAAGTGCGGCGACAGATCGGGTACTGTCCGCAGTTCGACG
CGCTCTTCGAATTGATGACAGTACGGGAACACTTGGATCTCTTTGCACGCATCAAGGGCGTGCCGTCTTCGCAAGTAGACACCGTCATCGCCGACAAAAT
CCAGCAGATGAACCTGAGCTCGTTCGAGCACAAGCTCGCGGGGAGTCTGAGTGGTGGCAACAAGCGCAAGCTGTCTGTCGCGATCGCGATGATCGGCGAC
CCGCAGATCATCTTCCTGGACGAGCCGTCGACGGGCATGGACCCCGTGTCGCGCCGCTTCATGTGGGACGTCATCGCCGACATCTCGACGCGCAGCAAGT
CGTCCACGATCGTGTTGACGACCCACAGCATGGAAGAGTCGGAAGCGCTGTGCTCGCGCGTGGGCATCATGGTCGGTGGTCGCATGCGCTGCTTGGGCAG
TGTGCAGCACCTCAAGAGTCGCTTCGGGGACGGCCTCATGCTCGACATCAAGCTGGCGACCATGGACGCCGACGAGCTGCAAGCCACTGTGCTCGAGCAC
TTCGGCGGCCCCGACCCTGCGCTTGTAACGTCGTCGGAGCTCAAAGACAAATGTCGTTTGTTGGGGGATGCGTCTCTAGCTAATCGTATCGTCGCGTCGC
ACCCAACTGGTTACGCGTTGGCCGCAGCCATGGAGCGCGACGGGTTCGTGCGCGCCGAGGCGTTGTGCTCGTGGTGCATCGAGGAGACGCGGTTCGACGC
GCTGCACGCCTTTCTCGCGAGAGAGTTCCGCAGCGACGGCGCCGTGGCCATGATGGAGCGTCAGAACGATTTCTGCCGCTTCAAACTGCGCGGCACGAGC
GCACAGGAGCTCAAGCTGTCAAACGTGTTTGCGCTGGTGGAGCGCGCCAAGGCGACGCTTCACATCCGCGAGTACAGCGTCTCACAGACGACGCTCGAGC
AGATCTTCAACCAGTTTGCGGCGCAGCAGGCCGAGGAGCAGGGCGTCGCGCGCGGCATGT