Description :
From Genome Similarity Track
Location :
contig_60:177669- 203564
Transcript NameFunction/comments
g9086.t1polyribonucleotide nucleotidyltransferase, putative
g9087.t1hypothetical protein
g9088.t1hypothetical protein
g9089.t1protein kinase, putative

Sequence
25895 bases(100 bases per row)
TCAGGTCAAATGTTTCTCTTTATTTCTGTTGTGTGGACTCTAAAACACCAAGGAGGAGAGGTGGATCTTCCTTGGTAAAGTAACTACCTACTTGGACTGA
GTGCGCGGGCGACGAGCGGTCTTGGGACGACGCTTAGAAGGTGATGCCGAGCGACGGTGGTGGCCATTGCTCGCACACGTCTCAGAGTCCTCGGAGGAAG
TTGAGGCGTCCTCGCTACCGTCTGCACCCAACAGCACACGACGGGACATTTTGCCGGAAGCACCATCCTGCAGGCACTCGAACTCCATCTCTTGGCCCTC
AGACACCACGTCATTGATATTGCTGATCTTGTCGCGCGATAGCTCCGAAATGTGCACGAAGCCACGCTGGCCATCTGCAGACTCAAGGATTGCTCCAAAG
TCCATCACCTGCGTCACACGCATTGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGCTAGAGCCCTGGTTATCATTGTCACGGCCGTTAT
TGTTGTTGGCATTGCTGTTGTTACCGCGAGGGCCAGCGTTGGCAACACCGGCAAGTTCTGTTTGAATCCACTCGCAAGCTTTCTCCGCGCTTCCGGGTGC
GCCCACGACGCGAACAATTCCTTCGCGGCGATCCACGATGCTCACCGAGACTTCGAAACGCGACTCCAGATCACGAATGTTGCTGCCACCGACACCAATA
AGTGCACCGATCAAGTTCGTGGGAATAACGCATTCCATGCTCACGTTCGGTAGCGAGCTTCCACTAGCCTTCAGGTGCTCACGAGGCTCGGCGAGTTCGT
TGCTCATGCGACGCAGCACGTGCAGGCGCGCCTGCTTGGCTTCACGGAGTCCCTCCTTCAATACCGAAAGCGGCACGCCCCCAGGAAGCTTCACATCCAG
CTGAAGTGCCGTCACACCGACTGTCGTGCCTGCCACCTTGAAGTCCATGTCACCGTAGTGGTCCTCCGATCCAAGGATGTCAGTAACCAACTGGTATTCA
CCCTCTTCGATACGCTTCTCCTGGCCAGCAAAGGGGTCGCCAGCAGTAACCAGGCCAATGGCAATACCAGCCACAGCACGACGAACGGGGACGCCCGCGT
CCATGAGCGCCAATGAGACGCCACATACCGTCGCCATAGACGACGAACCGTCTGAACCAACCACCTCCGACGTCATACGCACAGTGTAGGGGAATTCGGT
CACCGACGGCAGAATAGGCAACACAGCCTTCTCAGCAAGAGCACCGTGGCCGATCATGCGTCGGTTGGTGCCACCCACACGCCCAGTCTCGTTCACGCAG
AAGGGTGGGAACTCGTAGTGCAGCATGGCATGCTTGAGAGACGTAGAAGCATCAGGTTCAGCCTGCTCACGCGCCTCATGCAGAGCACCACGAAGGCGGA
CACCACGTTCGAGAGGTCCCAACGTCACGGAGCACAGCGTCTGTGTTTCACCACGTGCAAACAGCGATGAACCGTGTGCCATTGGCAGCACATCAGCCTC
CATCTCGAGCGGACGCACGATGCGAACCGAACGACCGTCAAGCCGCACGGGTTTGTTCTTCTGACCCTTCGTCTCCTTCGCGATGGTCAGAATGCGCTCA
CGAAGCACACGCTGGAAAGTGTCGTGAGCAGCACGCTGGATGGCAGCATCGTCAATAGGAGGTGAAGCAGCAGCAAAGGTCTGACGCATGCCATTCAGCA
TCTTGCTGTAGACTTCGCGCTCTCCCTGCTGGCGAGCAATCTTACCAGCGCGACCACTTGCAATCAGGTCCTCGGCACCCTTGCGCCCCAGCTCCTCCGC
CTTCGCCCAAACCTCCGGCGGGATGTAGAGCGACGAGTACATACGCTTGCGCTTGCCGTGTTCCGCCGCCAGCTTCTTCTGCTCCTCAATAGCCGGTGCC
ACATGCGCATGCGCTAGGTCCAATGCCTCGTCAAGACGCGCCTCCGTCACTTCATCACCCGAGGCTTCTACCATCACCGCACGCTCAGCAGTACCAGCGT
ACAGCACATCAAGCGTCGCGGCCTCACACTGCGGCGCCGTAGGGTTGGCCACCAGCTGGCCATCCACCTCGACAACACGCACACAACCCACCGGTCCGTT
CCACGGAATGTCGGACATGCCCAGCGCCGCCGACGTTGAGTTGACAGCCACCACGAGCGGGTCGTTGTTCGGGTCGTACGACTGCACCGTGGCCAGCACC
TGCGTATCTTCACAGAAATCGCGCGGGAACAGGGCGGATGGCGCGGTCCACCACACGAGACTGCAGCACCTCCTCGTCACTGCCAGTGAACTCGCGGCGC
TTCAGGTTGTCCGGGATGAGGCCTACAGCATACGACTTGACGCGGAGTCCACCGTGAGCGGCAAGAAGTCCCTTTGCACCACTCCGCCATTGGCCGAGGG
GTTGCCATTGCGGTCACCACTCACGACCGTTGTGAGCAGCACCGTGCGGCCGCACGAGGCCAGCACGGCGCCGTCCGCGAGTTTGGCGAGCTTGCCCACA
GTGTACAAGGTGTTGTCTAAGCTGCCGACCACCGGCTCCTTCACCTTCTTGGGCTCCGGCGGCTGAGTCTGAGTCTGCTTGGGCTCCAGCTGCTGCTGCT
TGTGCTGGTTCTGCAGCTTGGCGACCTCCTCTTCCTCTGGCGACGGCTTCTTGGCGCCGAACAGCAACTCGCGCAAACCGAAGAACGCGCGCGCCTGTGG
CGCTGCACCAGCGATACGAGGCACGCGTTGGCGAGCTGCAGGGATGGCGGCGCGGCGGGCCACGGCCGCGGCCGGCAGACGACGAGCAGCAGTGGACAGC
ATCTTGGTCAATGTGTGGCTCATGCAGCAATCATTGATTATGCTGTGGTGCACACTAAACCATGTTCTGACACACCACGCGAAACCAGCCAACCGTCTTT
GTTCAGCTATTCGACCAGCACAAAAACTTTCAACATCAAAAACAAAACGCTAGGTTTTTTTAAATCGCAAGGAATTGCACCATCCGTACTGGTCGAATAG
CTGGTTCCTAGAGAACGAAGTGGACCCACACAATCAAAAAGCTCAGTCCGTCCGCACCAGCAGACCGTACTTGCTCCCCCGCCCTCCCCCCGTCCTCCAA
GCCTCCAGACTCTTCAGCATGGGCACTCGTGTGTACGTGGGCGGCCTCCCGCGCGACGCCACTTCGCGAGAGATCCAGGACGGCTTCAACCGCTACGGCC
ATGTGTCCAACATTTGGGTGGCGCGTAACCCGCCCGGCTTCGCTTTCGTGGTGAGTTGAGCCCCTTCCCCTGCTGCGCGAGGCCTCGCATGATGGCCCTG
TCCTCCCTCTTTCTTCTACCCCTCTACCTCTCGGCGGCGACAGTTTTCCAGATCGGCAAGCGGCGGTCGGTGGCAACTTGTGTATGTTTTGTATGTGGTG
TCTAGTACTATACATGTTGGTGTATACGCTACCGCCGCTGCTTCCATCCGGCCCTCGGTGTAAGATGATTGTTGTCCGTCTGCTGCCCGCCGTCTTCGGT
GCTTCCTTCCACTGCCGGAGGGAGAGATAGAGGAGACGTCGCTCTGCCGACGATGGTGGAGCCATCATGCTGCGCCTCGCCTCGCCTCGCGTCTATCGCC
ATCTTCACTTTCGCCTGCAACGAACCAATACCAACCAACGCCTCTCCATCGTCGTCCTCCCCCATGCTGCTGCTCCCCACCTCTACTCTAGGACTTCGAG
GACCCGCGTGACGCTGACGACGCCATTCGCTCCATGGACGGCCGTGACTTCCTCGGCGGACGGTACGCGCTGCTGGGTTAAAGCGACTGTAGTCTACAAT
ACATCTAACTCTTGTGCTGTGAGCAGCATTCGTGTCGAGCTTGCTCGTGGTGGCAGCCGCCGTGATGGTGGAGGTCGCGATGGTGGCGGTCGTGATGGCG
GTGGCCGTCGCGGTGGCGACGACGACCGTGGAGGAAACTTTGGTGGCGGTCGCGACCGTTTTGAGCGTGGTTAGTATACGCTCCAGCCAGTGTCGTTCTC
GTTGGTGGACTGATCAAACGTGTTGCTGTGTGAACAGGCCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTGATGTGG
ACTGGCGCAACGTTAAGGACTTCCTGCGCACGGGTGGCGAGGTTACCTACTGTAACATCGAGGCCGATGGCTCTGCGTATGTATAACAAACCTTGGTGGG
CTGATATGCTTCTGATCCAGTTACTAATTCTTGTGTTATTTCTTTCGATGCAGTATTGCTGAATTCCAGTCCAAGCAAGACTTGGACGACGCCATTAAGA
AGCTGGACGACACGGAGTTCCGTGGCAGCTATGTGCGCGTCGCTGCTGAAGGTGGAGACTCTGCCCGCCGCTCACGCTCTCGTTCACCTGCTCGTGGCCG
CTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGTTGCCCGTAAGGACTCCCCTCGTCGCTCGCGCTCCAGATCAGCGTCGCCTGCCGCTGCCCACTCG
CCCTCTCCTCGTAAGGAATCGGCTTAAGCTGATGTGGATCGAAGAAGGCTGCAGATCTGCATTGGTGCGTACGCTACGCGGTGAGAGCCGTGAAGGTCTT
TGCTCGCTCACGTGTACAGTGGCTGGCAGCTCGACCAGCTTTGTTTGTTGCCTAGCGTCCCAAGGAAAACAAGCACATTAAACGATGGCAATAGCTTCCT
CTTATCATTTTACCCTAGTGTTAACTCTGTTCTCTAGCGTGCAAATCAATTCGCTGAGTGTCAAAGCCACATACAAAACCAACCTCACCAACAAGACTCA
TTCAATTTTCATGACTGCCTGTAGAGTCCTCAGTGTTAACTCCCAACATCGTCAATGTTGGGAGTTACTGAACTCTCTCCGGTATCTTGATTTCTAGGAT
GTCCTGTGAGCTGCACGCTGTTCTCTCCCAGCACATGAAACCTGTCAACATCATGGCAATCAAAGCCGAGAAAGCGACGCCGAACGACAACAAGAAGAGG
GAGACCTGCTGATGAAGGTGATGGTATTTGTGACTCCTGTTGCTTTCCTCTGCTTCCACCCCGTGAGCGGACTGCAGCGGGAAGCTGTTACGAGAGACAC
CCCTGCCGTGCTCTGCAGGCCAGTCCTCTGCTGATCTCCTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGAGCTTTAT
TATGCGCCGCACTTGCACGTTGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTAGTTATGAGAGATTCATCGTAAGTCAAAGATTCCTGATGCCGT
GGAAGGGAGCTTTCGATTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTACAGGTACTTGGAGCA
ACGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGGGCATCTTTTCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTCGGTGATC
TGCTTCGGCTGTGGACAACGCAAAGCACACATCGGACTGTCGTTAGCGGGCTGCGGGTCCATCTCCCTAGCTATCGCCGCATATCGAGACGCCTCCGTAC
CATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAGCACTAGCACAGTCAACACCAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCACGCGCCTT
TGGTTGGCCAGCAGTCTCCTTCCGTAAAACTATTTACGCTATCGACGCGTAATTACCTTCGTAACCCCTGATGAGGTACGTCGTAACTTGTATGTGGCGC
ACACCACTCGCCGGCACGTTTTTAAACAGAGCGCTACACTTCATCTCACTATGGACGTTTATTTCCTCAGTTGGAAACGTCCATCGGAGCAGCTCCAGAG
TCGAAGATGGCGTCCAACCAGGAATGCCACATCTGCCTGGAGGAGCTGCGTCAAGACCTGGTGGCCGCGCCGTGTGGCCACGTTCCACCACATATGCATC
TTGCAGGCGCTGCAGGTGAACACCCAGTGCCCCATCTGCCGCCGCCGTGCGGGCGACGCGGACCTCATCACGCTCTACTTCGATGTACCGGGCGAAATGA
GGCACCCGTCAGTGAACTGCAGCCGCTAAAGGCCTCGGGGGACAATGTGGAGCTCAGTTCGCGCGTCAACGCACTGATGGAGCGCATCCAGTGGCAGAAC
AAGCAGCGCGAAGGCATTTTAGGCGAACTGCAGAGGGTACGCAGCCAGAGTAACCAGTTACTAGCCGACAAGCAGGCTCTCGCACAGCGCGTCGGAGCGC
TGGAAGGAGCCAAAGTGGAGCTACTGACGAAAGTGGCGAGGTTCCAGATGGAGCTGAGTCGCCAAACGGAAGCTGCAAGGCGCTCCAGTGTGAACCAGAG
CATTGTTAGGTACCTGGAGACGTGCGACGCAACGGCTATGGAGGAGGAAATCCAGAACCCCAGGGAGCTAATTATGGCGCTGAAGAAGGCGTGCAAGTTC
CGTCATGACCAGTATCAGAAGGTGGTGAAAGAGAAGATGAGGCTCAAAGAGATGCTGAAGAACTCCCAGCCAACCGACAGAGCATACAGGGAATAGTGCA
AGGTCGGGTAAAGCCAAGGTTCGAACAGCGTTCGAGACCAAGCGTGCATATCCAGCAGCAGGTAACGACGGAATGGCGTTCGGAATTGGCGGCCAGCCGC
AGTTGGTGGAGAACAAGAAAAGGAAAATCGACTCGGCGTCAGTGGCATCGAATCCAATGCCACTCATTGACAATGACGATGATGTGGGTTTCACACCGCG
CTCTGAGTCGGCGGGCTTCCGCGCAAACGCCTACTCGGACGTATCGATCCGTCCGCCTCCGAGTTCACGGCAAACGTTTGGGCGCAGTAGCTTCAATCCG
AACCAGTACGGAGCTTTCAACCTGTCGCCAGCAAGCCAGCCACCCGTGCAGATGGCAGGACTCCAGGCTGCGGTGTGTCGTCGTGGCTATGATGAAACTG
GAAAGCTCACCAACTTTTTCCTTCCATTGGGAAAGGAGAGTGATTCACGGTCCATGCCTCGGACGAAACCCATTCCGAGCATGCAAAACCTGCTGAACGC
ACAAACAAGAACTTCGGGTCAGCAGCAGCGCATGGCGAGCAACGACCGACAGGAATACGCACTAACAAACTGGCTGCGCAATAACTGAAGGAGCCGAGGG
GAAAGCCCGAGGTCGCAAGAAGGCTCTGAAATTTGCGGTCAGAAAGCTGTACAATACGATACTATTTGCAATGTTAGCGGCCGACGATTGTCGTTCGCCC
TTTAAACTTTAAGATATGTTGCTTTTGCTTTAGCGCTTTTCTTGAGAGCTATGGAGTTGGAAACGGAGGTTTGTCAGTGTTGCTTGCAACGTGGCTTGAT
GTTCCTTGATAATGTTGATGACCTCAGCGTCTTGGCTTGGGAATTTCTTACCGGAAATTAGACGACGGCAAATTTCCTCGATAGATAAAAACGAAGTGTC
TGGGTTGCTGCATTCCACTTCTACTGATTCAGGTTCAGCTAGTGCTGGGTCAGCGTCGGCCATAGCGGTAGAAGGTTGCCCAATACTTTCATCTGGCTCA
CCGACTTTGTCGCTTGCATTTTGCCGTGAAATTGCCACAGTTTTCGATCGCCTCCTTCCAAGAAATGAGAATTCTACTGGCTCCGGAGGTTGTGGCAAAG
GCGAAAGCTGCTTGCAGACACAGTAAAGAAGCGTCGCTAAGTTGGCCAAATTCGCTGATGCCTGCTTGCCAATACTCTTGGGGCCAATACCTACATTCCA
AGGTGCAAGATGACATGCGGGATCAGGATCCGCACAAGCAGAAAATTGATCACCACTACGTTGAAGCGCAACTGACTACCACTTTCAACGGAAACCATTT
CCCCACTGCGACCATGCTCATCTGAATCAAGAAGGCTGGTTCCATCAAAATCCATTCTCCTGGTAGCACCGAGGGGGTCAAACGAGACTGCGCCGCTCTT
CGTCAAATAGTTGGTACTGGATCGAAGTACATCAGGATCATGGTCAGGTCTGCCAACAACTACAGTGGAAGTTACTCAACGTACGCTGGCGGGAAGTAAA
CGCCATCCGTAGAAATCCGCTTCCAGAAGTCCATGATGCCAAAAGGGACCTCCTTCTTATCGATCGCTTTGCCCAGTGATTGCAATACTCCTCTCATGTG
CACTTTCAGCTTTAAACAACTTCGCTGGATCCACAGCACTATCAATTGGATGCCCGTTACCCGCGAGAGGTAGCGCTGGTACAGGGGGCGACGAGCAAGG
ATGCCACCAAATTTCTTGCAAAACCTCGCAAACTTGACCCCGCAAGACCATTTTTCGTGCTGATGTCCACGTCTACACTTGGATCCTGAATCAGTGAAAG
CAATGGAGTTCTTACCACCTTTCCAAGCCACATGCGAGTGGCGTCAAAGTACACACGTAGCATCGCCTCAAAGTCCTGAGCAGATTTCGTCAGAGGAAGA
GTGAGATGTTAAAACCTTAAACGGTATGTGTTGTGAGCATACCCGGATTGCGCTCTCCTTTTCAGCCATTTTCTTGTTCATCAACAATTTTTTTAGACAC
AATGTGTACATGACAGCACGTACAGCGGATCGGAAGATTTGAAGAGGTTCCATCGCTTCAGCATCTTGGAACCCGAAGGGTGACACCTCATCGCTTTCAG
CTTCAGACTCTAGACGCCAGCGTGGTTTTCGTAGAGCGCCGCTGCTTGCGTTTTTAAGAGAAGCATTTAGCAGTGCCTCCAATCTCTTACGGCTCTCAAG
GCGCTCTCGTGCTTTTTGCTCGTTTGAGGTGCTGGTGTTCGCACTCACTGTGTTTGCAGTTGCATCACTTTCCTTTGCATTGTTACTGCTACCAACCACA
TCACTTCCTGTAGCGATATCCTCATCGTTTTCAAGTTTACCCAGGGTCTAAGCAAAAAGTGGTTAGTATGGTGAGCAAGAGGCAATTGGATCAGAGGCGC
ACCATTTCATCTTCATCCGTCCATTCAAACTCGGGAAGCCATGACAGAGGAGATGGAGTTTGCAACGTTGAAGAAACTTTCCTACTTAGAGATGCGCTGT
GTGATTCTGGCTGTATTGTTGGGGTAGATGGCTCCTGCGCGTCAGTAAACTGCATCCATTTAGTCTGTGCGTTAGCGTTTTCCTTTGTGGGGAATTAGGA
GACAGTGGCGGTTTGAATGGTCTCTCCGTGCTCAAAACATTATCAGCATCACTTCCACGCATTAAACCCAACAAATCAGCAAGTCATGATAAGCATTACG
CACAGTAGAAGAAATGAACATATACACGTACTGCCTTCGCGGAAGTAACAGTGCCATGATCTGTTCGTTTGGTGCACCAGTCTCTCAATAAGGCGCTCAC
TTGACTCGGGGAAGCGCTGATCAAATCGTGTTATAGGTGATGTTTCGAGTGCCCCTCCAAAACCGAGACGAGGAGAACCTCTTTGTACTGGATTACGTGT
AGATGCCTTGAGCTTGAAATCAGCAGTTTATTGAGCACAACAGACCTTCAACACATGCAAGACTGTGTCAAGCTGTCCTCACCTCATACTGGTCAACCTG
CATCTCAAGCCGCTTCACTTGAGCTCTGTCGAACATGTCAACACGACAATATCTTGCCTCAGATAAAATTCTGTGCCAGATACGATAAGCAAAGCCAGAA
TCAGTACCTCAACTCTTCCCGGCGTTCTTTGCGAGCCGCGATGAGTTGTTGCTGACGCATTCGCAGCAATTCATCCTTTACCCCCTCTTGACGAAGAGAA
AGTGCCATGCATTGTGGCGCAACTTGATGTAGCGAGTACATGTCACTCCTTGGTCCGGCGTGGGGCATGCCCACGAAATCGGGAGTTGTCTGTCTTTTTT
GGATGCATCATAAATGGCTCATAGACAGACAACTCAACTCGTGAACGATCAGACGTGAGACGAACAGCGAAATCTGTGTATTTCTCCGCTGGAATGTTTC
TTGATCAACTCTCCGCTGTCACTTGGTCCTGCTTATCAAGAGTATCAGTAGTGACAGGTTTGTCAGCTTCAGTGGCATTCTTCTGCTCCTCCTTCTGTTT
GCCATTGGCTTCTTGTTTTGCGATCTCCTTGCGTGCCGCTTCTTCTCGCCCGAGAAAATCGTTAGTCAAAGACTGCTGCAAGTCCTCGATTTCGTGGAAG
ACCTCCAGTGATTTCTCCAGGATCAGCGTAGCAGACTCCAGCGTGTTCTTTGATGCCTCTAAAGTCATGTTGGTAAACAACGTGTTTGCTTTGAAAGAAC
CTTTCGCCATCGTTGCCTGGACACCACGGATCTGGAACATGAATGCGGCAGACAAATGGGGTGCATGTAAATACAAATAGTGTAGCAGGGCAAAGAGCAA
GCAGCATATCGACATCTAATGCTGTTACCTGATCTGACACAATCCCGCACTCGCTTTGAGATATCCCCGTAGCGGCATTTCATCTTGCCACAAATCACAG
GCAGCGAAGCCTCCGCATCACTGATGTCCACCACGCCGGGAGTATGAATTCCTTGCGCTGCAACACGATCTTCCTCCGGAACAAAGGTAAGCAGCGACGC
CTTGAACGTGCACATGCCCGTTTTCTTCAGTCCATACAACTTCGTGTCCGATTCCGGATTGCTGGAAGGAATAAGCTCCACAGTCATGGAGTAGTGATCG
TTGTCCATACACTCGTCTCCGTCGTCATAGATCATGTATTTGTAATTCATCGTGATTGGATCAATGTGCCAGCCGCGGAAAATCCTACAAACACATGGAG
CATTCAATCAGCGCTTCTCCTTCCATTTGCCAATGACCTTCAAGTCTACCTTACCCGAGAATAGTGGGAATTTCCGGTTTCTCTTTCTCCTCTGACACTG
GTTCTTCCAGCTTCGCAGATGAATCTCCGTCCTCAGTCGTGTCCGGCACGTCCGCAACCACTTCCACCTCCACCTCGACTTTCTCCTCAATCTTGGCCTG
GATTGTCACATTTGCTAGGTGGCAGAAATCTAGAGTATAGCTGCAATAGCGTTAGATGGGTTGGAGTCTCTTGTAAAATAGCGTTGCGAAGAGCGTTCTG
CCTACGCTTTGCCCTGCTGCATCTCCCTCTCCTCGCGAACGCACGGCAGCGACTCGAGTTCATCAACAAATGGTCCTGCCTCACGTAACATAAGAGGAAG
GACGCACTACACGTTAGATATTTTACATTATTTCACACTTCGTCGCATCGCAGACTCGCCTTGGAATGCGGGAAGTGGATCGCGGGACGGCACCGGCAGC
AGCACTTGCGGCACCTCCTCTTCTGGGCGCGGGCGCGGGACAATCCGGATGTCGACCTTGGGCGCTCCTGTGCACAGCGTGCTGCTTAACGCCACGACGG
CCATCGCACCGGCGAACACGCTCCTGCCCCGCATACTCGTCGCTAGCTTGGCAATAATTGCAATAAATGTGTTTTCGCAGGGTTACTTCGTATGTTACAT
TTCGTCGGGTATGTTATGATACAGGTTGTATAACTATTGACGGGATTTCGCGAGTTGAAGATGTGGAGTGATGGTCATCAAGTTTCGTGCGGAATGCGCC
GCTCAGTGCGGAATTTGCCGTGTCGTGAGCAAGCGACCGAGTGAAGATGCAGGAAGACGGCGCCGCGGCGATTATGAGCGGCGTGCACCGGGCGATAGAG
CTCCTCGCCCGCGCTGCAGAAGCCTTGACGGCTTCATATGACAGTCACCAAGTTTCCTCGACGGATATTGATGCCTTGAAGCAAGTACTCGAAGAGCTTC
AACGCCTCATCCTCGAAGTTGGATCGCAGCGTGTACTGGAGCTGTCGGGGGCGCAGTTGATGAACGCTGGCGTAGAGTTGTACAACGCGCCTCGAGCTGC
TCTTCGAGCTCTTGAGCAAGTAGAGAAATCCAAGACGAAAACCGACTCAGAAGCTACGAGCTTACCACGGTATTTGTTAGCGGTCACGCGATTTGTAGCT
GCGAAGGTCATGGAACTCTCATTGGTTTGCTCCAAGAACGGCGGTGGTCAGGAAAATGGAGCGAGGAGAAACACGCAGTTCATGGATGAGTGTGTCGACG
TGCTGCGCTCGTTTGGACGAGTGGGAATGTTCTTGTTGGAGAGCGCATCAGTTGACTGTGAAAACTGCGAAGCGTATTTGGAGCTGGCAAATGAGGCCTT
TTCTTCTTCGATGAAGCTCTGGTCTCGTATTGGCCTCGCTCATTTGACAAAATTTAAGCAAGGCGTGGAGCTGGACGATGTTGTGGATGATTTGTGGGAC
TTTTGTACCCATCACGTACGCGTGCTCCAGCTGATTTCACAGCGGCCTGACAATTCAGCAGGAGAGGCTCGAGATATTGTGTCATTGCTGAATGAGTTGA
AGATGCTCGCTCCGTACAAACCTTCGTATGCCAGCAGCTTGCTTGATCTCATGCGCAGTGTTAGTGATGAATACAGTCAAACAGCGCAACACGAACTGCA
GGTGGTTTTTGCCGAGGAAGCGCTGCGTGTGAGTGAATCGCTTGAAAATGATGCAGACGAAAACTTTTCGGAGCTGGTTACGTCGTTCAAACAGCATGTG
TTGCTGAATTTGATGCAATCTCTCTGCGCTAATAATGACATCGAGCGAGCAGAAGCGTGTTACCAACTCATTCCAGTTAATCGGAACTCCAAGGTCCTTC
TACCCATGATTAAGCTCTACGTCGACAACGAACATTTTGATAAAGCACATCGCCTACTGCTGTCGTTGTTTCAACAAGACAACTTTGACGATTCCATCTT
GGGAGCACGCACATACGCCCAGGGGCTGTCTTTCTCGATCAAAGGAATGGATATTTATCGACACCTAGCCATAAACTACGGGGATTGCGCGCATGCCATC
AATGTGGAGATCGCATGCAATCTTGCTGTGGAAGAGAGCAACCGATACCGAGCGATGTCAGAACTCAAACGCATTGGCCTCGAATTGCTCGAGATGGAAC
GGTAAGAAACCATTGGGTAATCAGACCGGAATATAACGTCTCACTTTTAATTGCATATTACAGCCTAGGTGAAAGTGGTGATAACAGACTTGTCCAGCGG
GTTCAACAAACCATTTTGATGCTCTTCAACTCGCACTTAATTCCAACCAACACGAGGTAACGAATCAATAATGGTGTGCAGCGCGGCCAAATCGACTCAG
TTTCCAGCTTGTAGGACTGTTTGAAGTGGGCGGATGCGGGATTGGCTTCGGCGTCATCAGCTGATGATAAAGCGACGTACATGAGGTAACATTGATTTAG
AATGCGTGACCACTACATCAAACATTGATGAAAGTAATGCTCTGTAGGACGATGTCGCGTTCTTGCCTCCAGTTGGAACGCTATACTGAAGCTGGGGAGT
GGGCAGAGAAGGCGTTTGCTGAAGAGCCTTCTAAGCAATCTCTATTCACTGTTTTCCAAGTGGTCTACAAACAAAATCGAGTGCCTCAAATGAAGAGCTG
GTTCACATTATGGAGCAACTAAAAGGCAGGGATGATTTTGAGATCGAAGATTTCCTCGCCATGGGAAAGCTGGCTGATGATCTTAGCCCAGCAAGACAAG
ATATCGTGATGCACGTTCTCGACGAGATTTGTCGCACGATGATGCAAACTGAGGACTGCCCAGCTAATCTGCCCAAGGAAGTCATCCTACAAAATGCAGC
GCAGCTAGCATTCAGCACGTTCGCTCAGCGGCAGACTGAGCCAAGCCCTGCTTCAAGTATAATTTCCTATGGTGAGAAGTTCCTGGTTTACGCCTCTGCA
TTGCTGCAGTCATCAAGACCGGGTAGCATCGGCAATTTAGGGCCTTCTTCAGTGTTTGAGTGGTTCTATCGAATGAGGTATGACTCAGGATTTCTTTTAC
GAGTTGGAATTGCAAACTCACAGTGGTTTCTTGATGACAGCTTTGACATCGCCAAAACCACCGGAGACGCCAAGTTCTTTATCGTGGCAGCAACATTGCA
CAACGCAGCGACGAGCTGTACGGAGAACAATCCCCACTCAAGCAGCGATGCCAGCTAAGTTTGCTGGCAACGGTGAGCTCTGACATGAAAAATATAGAGA
CACTGGGCAAGAGTCAACTCTTGCGGCTTCTTGAAGTGATCGGTCGATTTGAAAGTATCGCTTGTGGGGACATGTACGCCAGTGCTGATGTGAAGATCTA
CTTGGTACGAAGTATGTTTTTATGCTTGTAGCAAGAGAAATGCTGTTCACCCTGATGATTTCTTGTCGACAGGCAAAGTCAGTGATAGCGGTGAAATTGC
GGCTCTTTGACGCAAACACGAAAGCAATTCTTGATCTCTGTAAGGCCACAGTGCACAGCGCCACTGACCTCATGCAGATTGGAGGTGTGGCAGACGCAGA
TGATTGCTACCTCTCGCAATTTCGCTTGCACTAACACTGTGTTGAAGATCTAGTGCTGTATGCTACAAAGTTCAACGAAGCATCTGAAGTACGGTTTTTT
CGGGCTCAACCTGTAGACAATTACACTCACACGGCTTACTTGAGCAGATTCGAAGCAGCTATCGATCACTTGCCAGCGAAATATCCAGCTTCGGGTACCG
GCTATAATGTGTTCATTCAGCCATGCTATTGAACACAAATTGCTCACCCGAATAACGTATATCGATCAAAATGCAGGCTCCAAATGCTGGTCCAAGAGGA
TTCCATTGACGCGAACAAGCTGTGCTATCTGCTCCGACGGCTCATAACGCTAGCTGAATCGAAGACAAAAGCATACGAGTGCTTCGACCAACTGATTCAG
TTCATAGACACTTTGGACGTCCCGCTCACTGAAGTCGACATGGAGTGGTTTGTTGTCAAAGCGTGGAACATCGTAAGTGAGCTTGTTGATCTCGTCCAAA
AGAAGTTGTACTTCGAAGTACTAACCTACGCAATATTTGTAGGGTGTGTCCTGCCATCGCAGCAATGACGCAGAAGGAGCCCTCCGGTTTACAAGGACTG
CTCAGACCATAATGCGTAGGCAGATACACATGAATTTTGGCCATCCAAATTGCAGGCTAACTCGTGTTCGTTGATTATGTGCAGAGCACAGCGAGTCCCT
CGTTGGAAGGTTGGGCAACAACCTAGACGCACAATACCAAACAATGCTACGAATGAGTTCCCTACCAAAGATTGGCGGGTAGTCAGCGCGTAGCGCCCTA
GCGCCCAACAGGATAGCGACTTTATCGACCGAGGCAAACAGCGTACAATTTACTTCCCCATTGCTTATGCCTCGTACACGTCAGGCGGAGAGCCATGACT
CGATACTCCACCCATGTGCGTCTTTATAGCCTCCATGTAGGTTCGCAGTGTAGGTAGGTCTGTCGTTTCTTCTTTCTTTAAGACCTTCGAGGCCCACTTG
CGCTCTGCATACTCACAAATCTGGAAAAACAAACGTAAGCGACAAGTTCGCAAGGTCAGCGTTCACAGTGAGTTCTACAAAACTGGAAAATGATAAAGAG
TTAAACCCACCTCTTTGATATCTCGGCACGAATGCTGCGGTGAGACAGTGGCCAGCTGCGAGAGCTCCTCGCCGGAGAGTTGCTTAGCATAACTGCATAG
AATAGGGAACACCAATACACTGCTTATAAGTTGTCTGCCAAACCACAACTTCTTCAGTGCAGAAGCTTACCGAGAAAACACCGCGCGGCGGGTCTTCTCG
TCAGGAAGGTTGTAGCGAATGCAGAGATCAAAGCGACTGATCAATGCGGCATCCAAATCCTGCTTTCTGCAGCATAAAACAGCAATTACGTTTACAGTTT
AGCAACCTCCCGATGCACAGAAGGCATCATCTGAAATTTAACAATGCATATACCGGTTCGTAGCGCACACAACCGTAGTCTTCTTAGCAGATGCAAAACC
TTCCACTTTTTGCAGTAGAACCGACAAAATTCGACGCGAAGCCTCGTGCATTGTGCCACCAGAACGGTCTCCGGCAAGGGCGTCAATCTATTGCAGACAG
CAATTCATAAAGTATCAGTAATGTTAACGCTGTACTTCAAAGTACACCAATAGACAACCAATGGGGACACGCACCTCGTCAATGAAAATAATGGCGCCAT
CGAGTTTCTCGCACGCGTCAAAGATCGCAGACATCTTTTTTTCGCTGTCGCCGTACCACTTGGACACCACACTCTCAATTGGGATATGTATCATTGGAAT
TCCAGCCTGCTGTGCGATGATACGAGCACTCAATGTTTTGCCAGTGCCCGGAGGGCCTTCAAATAAAACAGCGCGTGGACGATTGCTTTCGTAGCGGCAA
CGGGTTTTCTGCGCAATGCGCTCGTAAAGTTCTGGGTTCTGAAGCGCCAGCACAACCGTGTCTTCGATCTCGAGCTTCACGTCTTCGTATCCAGCCTAAC
CATACAGAAACATAACCAAGAGTCATAATTGGTAAAGCGCTACTGCTGTTTACCCCTTTTCAACAAATGCATACCAGACTCTCCCAGGTTAAACCGATTT
CGCTTTCTGTTGGCTCGAAGACATCAATACCTAGCCCTTGAAGCTGCTGGATTGCTTCCTCCTGCAACCAAAGCGCACCATGTGAGTTACTCAAAGTAGG
ACTACTAGCAAAAACAACAAGCCAACAACGGACCTTGCTGCCAGGGGTTGCTGTTGTAGCTGTGGTCGGATTTCTTCCACGTCCAACAAGTGCGTTCCTA
CGCCGCTGCTCAAGGTCATGACGGAAGAAGGCGTTCACGTTCGCGTACGAGTAAATCTCCTTGTAGGCACCAACAATAGCGTCGATCTCGCCTTGCGTGA
GAAATTCATCCTTGTAGAAAACAAACTTGGATGTCGCTTGCAATGAAGACGAATCACGCAAGAACTGGAACGAACCAGAGCCGTTCGTGTACAAGTACGT
CACAGCAGGCTGTTCGTAGGCCTCCACCACCGACTTCTTCGCGGTGTTATCTAGCGGCATCACCTCTACCGACTGCTTGGAGGCAGGCGTCGACGCCTTT
TGCAATTGCAGTAAGAAGCGACCAAGGATAGCTTCTTGGTCCACGAACGTCGGACACGCAAACTCGATCCGGATCGTCGACACGCCGTTGGGCGCGTGAT
CTTTGAGATGCCAATCTTCTTGATCGGAAAAGCCTTCGGGATGCGCGTCTCGGAGCTTTTCAGCGTCGTACGGAACTCCGACACTTGCTGGCGAATGGTA
TCCACAGCTTCCGCGTACTCAAAGTGCTGCAAACACAGTCACAAATGGAGCATTTAGTCTTCCTCTCACGATATATCTAATACTTCAATAAAAGGTTCCT
CCAACCTTCTCCTGCTTCTTGTCAGGGGCTGCCTCCAATTGTGTCGTGTCCGCATTCACCCCCACAACACCAGCGAGAGCTGCAGCAACAGCGAGCACAG
CGAATCTATTGGGGCCTGAGTCGCCAAAGGCCGCCACGACGCTCAGAGGCCGCAGCGCTTGGCTGGAAGGAGCTGCAATGCGACATAGAGAGGCATCCAT
GGCCACTGGCAGCCGCGTGGACTGGACCACGGCGCGTGCTACGAGCTTGACGGCGAGCCCTCGCTGCATCCTTTTGTCTCGGATTCTCAAATAGAAGTAA
ATAGTAATACCTAGGTTTCAGTAAATGCACAAAATTGGGACAAAATGCTATGTTCGAATTGAGTTTAACAGTGACTCTGATTAGGAAATCGTGCTGTCAT
TTTTCTTGCGACTTTATCAATTGATACAGGTCGAAGTGACGATCACATATGTAAGGGATTTTACGGGTTTACTCACAGGAGGTGCATGTTGTGCGAGGAA
AAGCGATATTTGTATTGAATGAGTGAAGGGAAGCAGCGTCACTATTCGTGACTCACTAATGCTTGACCATCTAGCGACCACCGCGCACAAACACTTTTTT
TGGTGGGGTCTCGGCAGCTTTCTGCTCTTCGCCTTCACACCGCTGTCGGAAGGTGGCAAGCTGTCGTCTAAGGGTGCTGATCGTCTGGGCTTTCTGGGCA
AGAATCTGGCGCACGTAAAGCGTCGTCGTTAGATTTGTAGACGCCATGGCAAAGCGCTCAGGTACCTACCTCTTCCAGACGCGAAACATACTGCTCAATA
CTCGCCGAGTCGCCAGTAGCGTCGTTTTGAATAGCTGCTAACATGGCACCTTCCTCTGTGAGTAGCTCTGCATTTTCCTGGACATATCCATCAATAGCGC
ATTAGGCACGAAATAGCGCAGTTCTGTTGCAGACAAATAAGAGTAACAAACCTGAATTGCATTCATGTGTGTGCTGAGCAAACCCTCCTGCTCTTCATAC
AGAGTCTGAACCTGTAGTCATGCACACACTATTGTCAGCGTTGCTGTCCCTTTCAGCACATACAAGTTAGGCAACAAGCTTAGCATTACCACTCCCTGCC
ACGCTTCCTCTGAATATCCGCTTTCCAAGGCAGAACCACTTCTTTTGTCTGCTTGTACAAACAGATTAGAGCCATGTAGAGGATAATCGCAAAGATAGCA
GCGTACCCGAATGGTGCCGACGACTAATGCGGAGAATGCTCAAGTCGTCGCTCAAGTCGCGCGTGTGATGCGAGGAAATTGTCACTACATCCCTATTCCC
ACCATCAGCATCGCTCCTGTACTGATCACCACCGCCTTCGAGCATGTCATTATCATCGTCTTCTTCTTGACATTCCTCTTCCTCCTCTTCTTCTTGCTGA
TACCCGTCTTCGTCATCAAACTCCTCAGCATCGTCACTCCCATCTTGGTTGGGATACGCGTCGTCACCGTCAAGATCTGTTTACGGCACAACGTAACCTC
AACATTAATGTTCATCCCATGGTAGCGATTCCACGAGTTCACACGCACCCTCTTCAAATTGGACGTCTTCGACACCCACAGCATCAGACTCAGTATTCCT
CTCATCAAAGGCATCCGCAGAAACACGCTTCTCTTTGACCCGATCAGCATAGCGAAGAGTATTGATCGTATGGTCCGAGGACGAGGCACACGGCGAGACA
GCGGCAATCATCACCGTCCTATCAAACAGAATTCAATCAGTTGCAAAAGCTGGTTGGTGCTGGATATCTTCAACACGACTTACTTCGCTTTGGCATTGAC
AAACGAATCTTTTAATACTTGGGTGAGCTTGCTTGCTCGAAAAGGGATATGAGTGCCTCGACCACCACTATCCAGCGCTCTATTCATCACAAAAATGCAA
CGCAAATGAAAGGATTAGGAGACAAATCTTAACCGGCCGCCATTTATAACGTACCGAAAGCACTCCTTCAAGGCCAGCAAGCTTCGATTGATTTCCGCAG
ACTCCAATCGTCGCTGCCGATTGTGATTCTTTGTATCTTCACCACGCTCACTACCCGCAAGATCGATCAATGACAATTTGCCGTGGAGTTGCCCAGTTGC
TTTCTCACGAAGATTGATCTGGCAGATGCAGTGTGATCGCGATGAAACATCATTCATCTCCGTGGCATGCGTCGTGCGAAGACTGTTGCCTTTGCTGATC
ACTTGCAGCAGCTCCTCAGTATTCTGCGGTTGTACCTCCTCCAAATCCACAATCTGCACTTCGCCTGCGCCATCTTCACGAATCGTCAGCACCTGTCGAT
GCAACAAATCCTGGCATCGACCACCATAAATCTCAAAGAAGCTCACGCAAATATCCAAAGGATATCCGCGTCTTGCGAAGTCGTCGGCCTGCGCAAACAC
ATCTGCCGCAATCTGGCTCTGGATGCCTTGCATCGTGTGCGTCTTGCCACTACCCGTTTGTCCGTATGCAAACACCGTAGCATGGCCTCCGTCATGGAAC
ACAAACTTCACGAGCGGTTGAGCTGTGCACATGTACACACTCTCATTCGTCGCATTCTCATCAAAAGTCTAAAAACAATAAACAATTATCAAACACCAGT
CCACAACCTCCATACCTCACCAAAATGCCCCGTACATGGTCGAAATTGAAGGCGTTGCTGTCCAGATACTTGGTGATACCGTCCACCTTGAGCTTGCAGT
AGTGCACGATGGACATGGGGTTGAGACACGTGACGGCGTCGTAGTCGTGCTTCTTGACCTCTTTGGCGTTCACCGGCCGCTTGCGCACGCAGATGGTGAT
CTTGGTGTCCCCCGCCTCAGCGTGTGGCCGGCTGCGGTCCTTGTTCTGCTCCCGGAAGGCCTTGATCATGCGCTGGAAGTCCACGTCGCCCGGGTGGCCC
ATCTTCTCGTTTAGTTGGCTCTCCCGCTCGCGCTCACGCTTGGCCGCCGCCATAGCGCGTCGTCGGTCCTCGCGGTTCTTCTCGATCTCGGCGATGGCCT
GCATCGTCGGCTTGGTGCGCGGCGTCGTGGAGGGAGCCCCACGGCCGGCGCCACCGCGCGCATTACTCGCTCGCCACGCCATCCGTCGTCGGTTAGAAAA
ATAATCCACCAGCGTAATTATCAGATCCACACTTCAATTTGGAATCAGAACGTCTCAGAAAAAGTGACGTTTCTGATTCTAGTTGCATTTCAAAATTGAC
AATTATGGCAAGGCAGGCGACCTCGTCGACGCAGTTGGAGGCGGCGATCGACGCCGTCGCGAGCGGCGCCATGTCGCTGCGCGAGGCCGCGCGCAAGTTT
GACGTGCCCCGAACTACACTGCAGCGCCGTGTGCAGCGCCGCGCGGCGGAGGTACCCGAGTCGGAGGAGGCGTCAGAGTCTGCGGCGGTCAAGGCGGAGC
CTGTCACAGTTGATTGCAACGCCCAGAGCGACACGAGCGGCGAAGAAGCTGCAGAAAGTTATACTGAGGAGCATGGAAATACTGCAGAGCGTGACCAGAG
TAATATTACAGGACGCAAGCGACTCGCAGAGCAAATGGAGACACCGAACCAAGGTGGGCAATTGGGTAGTAAAATTATATTGGTTTTAGTGGGGTTTGAC
CGACTTTGCGCGTGGATTTAGGCCCGCGGAAGGTCATCAATTGCAAGATTCGGATGCTGTGTACGGCGGCCGGGAGCGCGTTGGATGAGTTGAGCAACAA
GATGATCCGGGAGGGCAAGTGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCCATCCCGCAGTGCATTGTTGATGAGCTACGGTGGGTGGAGGTT
GTAATTGAATTTGGGATTTGTTGAAGCTGAGCGTGAGTTTGATTGCAGCGCTAACTCGCATCAGCGGGATTATTTGCCTGTTGCGGGGCTGCCGGAGTTA
TGTGACGACATTGCTGCGTGGGGGGATCGATTGCATATTGACTACTCGCGGGATGACGTCTTGGTGGGGCCTGGAACTAAAGAGCTGCTGTTCGTCCTAC
AAACGGTGTATTATGGAGACCTACTGCTGCCCAACCCGAGTTGTACGAGTTACGCCCCGCAAGCAGCTATTGCTGGGAGGTGGGTACTTGAATTGTATGG
AGTTTGCGCGTACAGTTAGTGAGGCGCAGTCTAACCTAACTCTGCGTAAAGAAACATGATGTGGCTGCCAACTCATGCAGAAGATCACTTCGTGCTGCGT
CCAGAAGTGCTTGAAGCGCACTGCTCGAAGGATCCAGGTACGTGCAGCTACAGTTAGCTTACATCATAGAGCAATCGGAGTTTGCTGACACGGGATTATT
ATGTAAACCGTCAGACGCCCCGCGGATTCTCATTTTGAACAGCCCGTCAAACCCAACAGGGTGCGCTTACCAGGCCGACGAGGTTCGTGGTTCTGCCAAG
ATTTCAGTAGAGCGACGATAATACCCACCTGACGTTGCTTCGTATGTTGTGTTCATTGATCATCGCTGACCAGCTGGAGGCACTAGCAAAAGTCGCTAGG
AAGTACCGGATTCTCGTTGTATCTGACGAAATCTACTCGGAGCTGCATCATTCCGGCACACATCTGTCGCTCTCCAAGTACTACCCGAAGGAACCATCGT
TTCAGGAGGATTGAGCAAATGGTGCGGTGCTGGAGGTTGGCGCATGGGCTTCTGGTTGTTTCCGCCAAGTATGGGCTGGTTGCGCAGCAGCATGCTCGTC
ATGGCGTCCGAGACGTACACGTCAGTTGCATCGCCTATCCAACACGCTGCTCGACGGGCGTTCGTTCTTGAGTAGGCAGCACGATCCAACATCCTCGCGA
GAAAGCGACGCCAGACCCCGATTCTAACATGTTGCCTTGTTCTGCGCTGTAGTTGCGTTGAGCTGGCATCGTACAAACGCAAGTGCCAGAAGACGCTGCA
GCTCATCGGCCGCTGGTTCTCGTACCAGCTGCAGAAGATGGACGTCGAAGTGCAGGTCCCGGAGGCGGGCTTTTATCTGTTCCCATGCTTCCGCCGACAC
CGCAAGGCGCTCGCGCTGAGAGGCATCTCGACTGACGAGCAGCTGTGCGCGCAGTTGCTGCAGGATACGGGCGTGGCCATCTTGCCGGGCTCGGCCTTCG
GGCGTGCGTCGGAGGAGCTCTTCGCACGACTGGCGTTCGTGGACTTCAAGGGCGACCTCGCGCTCTATCTCATAGAGAGCATGGTAAGCAATTCCTTCAA
TGTGAGCCTTTGCCACCGAAAACTCGACTCACTCACCCCTAACGATATTTTGTGCAGCAAGATGACCCGTCTTTGGAGGCCATCGAGGGCTTCATTCAGT
CGGTCTGCCCCAAATCTCGACATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCTTGCGCGGCCGTCTGCCGCGCCAGCAACGGCCAGCGCCTCAGGCG
TCGCCTTCTAACGAGCGAGCAGGTCGTGGGGAAACCGGTGTGCGCTCAATCGGTCGCCAACTGCTGCTCGCCGAGGCTGGAATTTTGTCTGGAGGTGCAC
GTGAATGGCGCAATGGAGACTCTTGCCAACTCGCCGCTGACGTCACACGAAACCGCGCCCTGTGACGTGCTGTTTCTTTGTCAAACGAGAAGGCATCTTA
TTCGCAGCATTGCATTGAACCGCTGTCCACGGAAGCCCAGCTGCAGTCGACGGAAGCTCCGCTGAATTGAAATGAGTTGGTGCCAGTGATGCCACTTTGA
GCTTCTGCTCCGGGGCCAGGGCTGGCCACTTCTACATGGCACTGCGCAGCCGATTTGTGGCGAGAAAGTAGCGCTGCCCGTCCGACCCAACATGGAAGGC
CAACACCAACAAAGCCAAGTCCATTCGACCCACCCTGGACGGCCAACACCACCAACAAATCCAAGTCGGAGCCATCCACAGGTCCGTGGTGGTTTCGTCC
GATCGATTGATTACAGTAGTTCTCGTAAATTACACATACATAGCCTGCAACCCAAGCCTCGGTACAAAGCCACGAAGAGACGACTGGGGGAAGTTGTCTC
GGCATTTCACTTGCTGACTTCTCTCGCCTTCTCGATGCCTGCGGTCGACGAGTACCCGCGCCGTACGCCGCCCCGGGACGCCGCGGCGCGCTCGCGCTCG
GCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGTTCCAGCACCAGGTGCAAGTGAGCGGCAGCAGCAACCTGCGCGCGTCGTACCAGGAGCCGCAGCCTT
CCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAGCGCGCAGATGCGTCACTCGCTCACGCACGTGCAGGGCTCAGACGCGCAGCGCTCCAGCGCGTCGTC
CACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGTGGCTCCAACTACCTCAATCTGCACACTACAGGTCGAGAGTTGAGCCCCCGCCAGCAGCTGCACCCG
GAGTACCCGGCCGCGCCCCCGCGGGCGATGACGTTCTCAAAGTAGAGATCCCGCGGTGGAAGTCGAAGCTCACGACGGACAGGGCCGACAGACTGCACAT
CCCAGCAGGAGCCGACAGTGCAGGCAACTCGCCCGTGGCCAGCGGAGCAGGCAGATCTTCGACGTGGAACGGCAAGGACGGACGAGGCGGACACGGGGGC
TCCATGGGGGCGCTGGTGCTCGGACGGGACCGAGATAACGGATCCAAGAAGCGCTATACGGTCTTCCAGGTGTACGTGCACTTCCAGTCGGGAGCTGTCC
GCGTGTCTGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACGCTGAGGCGGAAATACGCAACGGTCGGGAAACTCTACTTCCCGCCCAAGAAGTT
CTTCATGTCGCTGTCGCTGCGTGTGATTGAGCAGCGCCGGGAAGCGATTGAGACGTACATGAACGCGGTACTGACCCTGCGACCACGGCCGATTGAGGTC
GTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTGGACGACGAAGAAGAGGATGGCAACAGTACGGACGGACAGGCGCGCGGCGTGGATATGGTGACAGCTC
CGAAGCACGTGCAGTCCACGTCCACAGCTCTTGGGACGTCTTCGCGGCTCAGCGCCAGCAACAGTTTTGCCTCGGAGGACGCAGGGAATCATTCCGTGAC
GATGCAAGACTTTGAGATCCTGAAAATGCTCGGAAAGGGGTCGTTTGGAAAGGTCTACATGGCTCGGGAGCGCGGAGGAGACGGTAAGATCTACGCGATG
AAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGCAACCAGGTGGGGCACACGATGATGGAGCGCCGCATCATGAGCTCCATCGACCATCCTTTCATTGTCG
GGCTCAAGTACTCGTTCCAGACCGCCAGCAAGCTCGTGATGGTCTCGGACTATTGCTGCGGAGGCGAGATCTTCTTCCACCTGAAGAAGTTTCGCTCCTT
CTCGGAAGCTATGGTGCGCTTTTACGCCGCGGAGTTGGTGGCCGCCATTGGCCACCTGCACGAGCGTGACATCATCTACCGCGACCTCAAGCCCGAGAAC
ATTCTTCTTGACGAGACAGGCCATGTGCGACTTACCGACTTTGGCCTCTCCAAAACAGACTGCACGGACTTCACAGGCGCCAAGACGTTTTGCGGCACCC
CCGAGTACCTGGCACCCGAAATGCTCATTAGCCGCAAGAAGAAGACGGAGTACGGCAAAGCCATCGACTGGTGGAGCCTTGGGACCCTCATGTACGAGAT
GCTCACGGGCTGGCCGCCTTTCTTTGATCGCAATATCGAGCAGATGTGCACCAAGATCATGAAGTCACCGCTCAAGTTCCCGGCTCACTTCGGTCTGAGC
TCTGAAGTCAAAAGCCTCATTTCGGCACTGCTGGAGCGCGATCCGACGTATCGCATCGGCTCACGCCCCGGTGCTGGCGTGGAAGACATTAAGAACCACG
TGTTCTTCTCTAGCATCGACTGGAAGTTGCTAGAGCAGCGCGGCGTCAAACCCCCGTTCAAGCCGCGTGTGCGCAGCCCGACGGACATCCAGAACTTTGA
CCGTGAGTTTACGAAGGAATTGCCTGATCATGGTTTCTTGCAGCAGGATAAACGACTTGCAGTGTCACCCAAGAACGAGTTCCAGGGATTTTCCTACACT
CGAACGGAGGAGCCAGCATCAATGTCACGAGAGTCAAGCAGCAAGCGAGAAAAGCGCAGGTCAGGGCGCCGGTCGGAGCCGCGCCTTAGCGAAGGGTACG
TACGAGGAAGGCATTGAAGCAGCGCTGGACGCCGAACTACTCTTCTGGATCTTCGTAGGGGTGCCTGATTCTCTCTCTCTTGCGTCTTGGGATGGGCCTT
GGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCAGCAGATCAGCAGTATCCCGAATTCGGCCTCGTCGGCCGTGACAGCACGGATTTCGACACTGGT
TGTATCTAGAGTACGTGGAGGCCACCGCGCTCGTCGTGTCCAGTACAAGAAGGAGGCAGCAGGTGGGCACCAGGAGCAAGTACATGTGATGATATTCTGT
TTCTAATTAAGACTTGGTACAGGTACGGAGCCGATCCGAGTGGAGTCGTTCGCTGGGAGACGTGAAGTACGTTGTAAGAAAATGAATGAACCTAA