Description :
From Genome Similarity Track
Location :
Scaffold_3:177634- 185693
Transcript NameFunction/comments
Physo_247031Hypothetical protein
Physo_329088Hypothetical protein

Sequence
8059 bases(100 bases per row)
AGGAGATCGATCGGCTGCGAAAGAAGATCTGGCACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCGGGGCGTCACCTGCGA
CATCGACGTGGGCGACGCGAAGCCGATCGCTCAACGTGTCCGGAAAGTTGCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCA
GCCAAGATGATTCGGAAATCTGGATCACCGTGGGCCTCGCCGATCGTCGTGATCATCAAGAAGAACGGCATGGATATCCGACTCTGCATCGATTATCGGC
TCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGCCCTTGATCAACGATTTGCTGGATGATCTGGATAAGGAACTCTGGTATTGCTCTTTGGACAT
GGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGATCTCGGCCTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTC
GGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGCGTTGTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGG
ATTTGATCGAGTCAGGAGAACCAGAAGATCCGGGGCGTCCATCAGTGCTAGGTCGCAGATCGTACATTGATGACATTCTTGTGACGGCCGGATCATGGGG
TGAGCTGTGCGATCGTGAGCTCTTGGGGGATGCGTAAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAATCCGAAGGATCTCAC
TGCTCTGACCGATCTGCCGTTCCCCGGATCGCTCCAATCGATGCAGTCATTATTGGACAGTCTCAACTACTACAGCCGTTTCTTGGAAGATTACGCGATC
TACGCGGCGATCCTGTATGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAGCGCCCTGATCTGCGCCAGATCCTGGACCGTCAAGTGCCGAACTCAG
TGGATACGGACCCAGTGAATCCCGATCGGACTCCGCCAGTTCCTGAAGTCGGGGTCGCCTATGAACGCTGGATCCGTGCTCATCGTGCCTTTTCGACACT
GAAGATGAAGATCGCGACGACACCGATCCTGCGGCACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATCTCGGCCGCA
TTGACGCAGGAGCACGACCAGATCTATCATCCCGTTACCTTCGCCAGTCGAACGCTGACGTCGAATGAATTAAACTACAACGTGGTGGAGAAAGAAGTGC
TGGCGCTGTTACGGAACCTGGACCTGAACTATAACATGCTGGTTGGACGATCGATCCGGGTCTTGACCCGACACTCGACGTTGGCGTGGCTGTTCCGATC
ACCCGGCCTTCAAGGCCGATTGGGTCAGTGGGCTGCACTCCTATCGCCCTGGACACTGGAGATCACGAAGTGCACCAAGGGAGAGGACGAGAAATTGGGG
GCGATCGCCGCTAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCAGGCTCCGATCC
CGACTGTGCGTGCGAACGAAGAGCTGCTGGTGATAAGTTTGAATGGATCTGCCCGCGTTAAGCGAGGCGGAGGCGCATACAGCGCGATCTTGTGGAAGTT
ACCAGAATGGAGTGTGGTGAAGGCCCGATCAGGCTATGCTGAAGGGCTGAGTGTAAACGAGGCAGAGTATCATGGTCTGTTGTTGGGTTTCGATCTCCTT
GACGGCATAGATCAAGGCAGGATAGTGGTCTGCGGTGATTCCAACCTGGTGATCCGACAAGTACGGGGCGAGATCGACTGCAAAGCACCTAAGCTGACAT
TGGTAAAGCAAAAGGTGCTGGATCGACTACGGAACTGACCAGACCACGAGCTGTTACATGTGAAACGAGACTGGAACGGAAGTGCGGACAGCCTGGCCAG
TGCAGCACTCCAACGTGAAGGGGGCGTCGTCGTCGAGGAGGATGCCGATCATGGGGATCTAGTGACACTGAACCGACTTGATGAGATCCTGGTCGCCCGG
TCGGATGAGTCGATCGCCCGACTATCGCCGATGACGACCCGATCGGGCACCAGATCACGGCCGAACCCGACAGTCATGCAGGACGAGTTCGTGCGAGGGT
TGAGGATCGATCGGATTCGTCGAGTGCAGGCTGAAGAAATGTGGATCGCGGGTATGAAGAAGTATCTGATGGGAGATGTGGCTGATCTGACACAGGATGA
GGCTCAATCCTATGGCAACCTCGCAGTGGACTACGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCACCCTCCAAGCGATCGGATGCAGATCGAGAT
GGACTGATGAGACTGGTAGCACCGGAGACGCTGCATCAAGACATCCTGCATCACTATCACTCCACTCTGAAAGATGGACACCAGGGGATTGGGCGTACAT
ACCAGCGGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGTCGACTGCGAGACCGGCAAAGGACGACC
CACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCAATGGATCACATACCTTCGCTACCCAAGTCGTACAAGGGT
ATTACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGTGAAGGCCAGTTCCTCCCGAACGGCGCCGACGATCGCCGAATCTTACGAAG
AGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGATTTATGGCTGACTTCTTCCGCTCCTTGAACAAGATCCTGGG
TATGCGCCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGGTAAAAACGGCGACGAGAGCCCTGAAGATGTTCGTGGAG
GATCTGGATCAGAGGGATTGGGATGAGAGTACGCAGAGCGATTGATCTTCGCGATCAACACGGCTCAAGATCGGGTCCGTGGAGACTCCCCTTGTTATCT
GGTGCATGGATGGGACCCTCGATCGACGCTCGAGGCTACGATACCTTTGGGTAGTACCCGGACTCGGGATCGGGATCCTCGACGGTGGCGGTATCGGATC
CAGAAGCACTACGATCCGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATTGCGGATCGGGCCAATCAACACAATGAAGAAGTTCGACCGCACT
CGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGTGTGAAAGAGGGGTATGCCCGGAAGCTGGCTCACCTGTGGCACGGCCCGTTCAGTGTGGC
GGAGAAGGTGAACGAGTACACGATGAAGCTTCAGATCGCTGGTACGGACTACCACCTATTCCCGATCGTGCATGTTTCGAAGCTGAAGTTGGTCAGGGAC
TTCCCCGATCGACCGCAGATCGCACCCACGGTGGACGAAGCAGATCGACTCGATTTCGACGAAGTCTTACTTCCGGAGGACAGCTGGGCCCCAGATCGAG
ACTCGAACGAGTACGAAGTGGAGAAGATCACGGATACGAGAACAGGTCGCAGGACTCGGTATGGCCGGACGTATCGAGAGTTCCTGGTACACTGAAAGGG
TTATGACGAGCCTGACCGGGTCGACGAGGCTGATCTCAAGTGTGGAGCTTTGTTGCACCAGTTCCTTCGAGATCGCGTGAACCGGAACCGATTTGGTGCG
ATGCAGTCTCACGAAGAAGAGTGAGATCGGACCGCCAGGGCGAGCTGGTCGCCTTGGTGAGCCAGGTGAGTGACGGATCGACGGGGAGGCCGTTGATCGG
AGGAAGGGGTTTTATATTCAGATCGGATGGTTATGGAGCAACTACAAGGCGCTACGACGACGGATCTGGGCTGATCGGGTTGGTGGCGAAAGGTGGTATG
ACGATGGATCTGGACTGATCGGGTTGGTGACGACGGATTGACTTGAGAGAGGTGGCCAACAGTGACGAAGATAGCAGTGGTGTTTATTGATCCGAGACTT
TCATGCTACGAATATTGATCCGAGACTTTCATGCTACGAAGATGCGCGATCGGCCTCCAAAAATCGAAGATTTCACGACAGACGAGCTGACCAGCTGGAC
GCTGAATTCGATCATCCGAGCTGGGGGATGCTGTTGTTGCTGCATACACTCTGTATTGGGGATAAGTTCGTTGAGGAGACAAGCGATCGGCTGTTCCAGA
CGATCCTGGGGCGGTAGCAACCTTTGGGTCCTGCCGGTGATCGTCGGTGCCCGCCTCGATCAAGCGGAGTAATAGATTTCACGACGAAGTGTGAGCCGTT
GATACTGGGATGGTGAAGTCTTGTCCGCGGTGAGCCGCCGTGGGGCCCGACTTACGGACAGGGGGCGGTTGTGGTGAAGCACCGAACAAGAATTTCCAAC
TGCGATGACATCAAGCGACATGGTGGCAGAACGATAGGCAGGGATCAGGCTGCGGTCGCGGATCAAGAGGGTCTATCGAGAGATCTCAAGCGATTGGATA
ACGTCGACGCGTAAGGCAACACATATGTCAAGACAGATTACGGGCGATCGCGCTTGGACTGCGGCGTGATTCTACGTAGACCCAAGCCCGGATCGACGAC
CAATCTCGCAGATCTAGGGCGGCCGAGGACAGAAGAGGACGGATCGGCAGCGCACGGCAACTCGCACAGGTCATCGATCGGGAGCCGATCGTAGATCGCC
GATCGGGGTCGATCGTGGATTGGGAGCCGATCGTGGATCGCCGATCGGGGTCGATCGTGGATCGGGAGCCGATCGTGGATCGCCGATCGACCCGGATGGG
AAGCATATGGGGGCGAAGCCAGGGCAAGAATCCAGTAATCGTTTGGTTGTAGGATTGGTAGATGGGATGGCAGCGGTAGAGAGAGACCAGCTAAACATAA
ATCAGAGCGCAATTTGCACAGAAGACCACAAGTGCCCTCAAGTCGTCAAGTCCCAGGAGCTACATTGGCCTCGGCAAGCGTTGACACTTCGGGTAGTGAA
CTAGCGGTACGGTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTCTAGTGATCTTTCTCTCGTGTGCAAGTCCTCGATCGACCGGATACTGCTT
GGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATTCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGAAAGGCAACTACAG
GCCTTGGATCTACTCCAGGCCGACCGATCGAAGCGAAGAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGACTACCGCGCTGCTCCACAAACT
ATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCCGAGAGAGCAGATCCAGCCCGCCGACGGGTACACAAGGTGAGA
ACAAGTTCAGCCGATCACGGATCGTAGGGGGACCCCCTCCGTTAGTCGGTGTCCGGGCGCTGGTGGGAAGCTCGATCAGGCCTTAACCAGATTTTGGCCG
ATCCCGCTACACCACATGTCCGAGCGCCCTCTTCTACTTTTTTCTCTTTTTACTCTTTGGATTGGACTTTGAATTTCTTTTCGAGCGACATTTGGTCGCG
ACCTACTTGTGTGATTTTCGACTATTCTTCTAAGTCGAGGATGGCATGGCTAAGACAAGACGAGCAAGTGTGGCTGATAGAGAAAATTATTACTTCAGAA
ATTAACGAACTACTTGAGACTGCAACTATTACGACCGCCGGTAATCTCTCTCGCTCTGCACAAAGCTGCTCACTCATCGATCTCGTCGGTCTCCAGCTCC
TCTTCCTCTTCGTCCGACTCGTCATCTTCCACTTCGTCGTCGTTGTCGTCGGACCTTCATCATCGTCGTTGGAGACTCCGTCTTCACCCTCGTTGGCTGC
GCCTGCCTCCTCTCCCGTGGTGATGTACTCCAGCTCGCCCGACGCCTTCCTCTTTGGCTTCGCCTCGGCTTCCACCACCATCTTGGCGACGATCTCATCC
GGCTCCTCGCGAAAGGTCGGGCTGCTGTCGTCGACCGTAGTCGCCGGGCCGCGTGCTGTGGGTGTTCCGTCTGGACGGTACGGTGGAATTACGCCCGCCT
GACCGCCCTCCTTCGCGTTGTACGGGTTCACCTTCATCGGCCGAAACTTGCCATCGCCGAGCTGCGTCTCGACCTTGACACGCAACTCCGAGATCGTCTT
GTCAGCAAGAAGAGCACGCATCGCTCCTTTCGTGAGGGACGGAACCCAGTGGTCGGGCACGGGCGTCGGCGACGTGATATCGAGCACCACGCGCGCCAGG
GCCTTGCCGCTCAAACGGTGAGAATGCTTGGCCGTCGGGACGAGTGCTCCAGTCTGCACGAGCATCTCGGTCAGTGTCTGGAACCGCGGCGAGTCTACCT
GGAACGGCTTCGTTGCGTCCCGGATACGCAGGCGGTACGCCTCCTTGTCCTTCTTGAACAAGTACCTCAAGCCGCGCACGGCCGGGAGCGTCGTCGCTTC
TCCGGTTGGCGTAGCCTTGCCCGTCGGACCGCCCCACTACATCAACTCTCCATTGCCCGACGCTTCCAGACGCCTCAAGAGACGGAAGTAACCCCACGTC
TCAATGAAGAGACTGACGAGGCGGAGACGTTCGCGCATGGCGTTCATCTTCCTCTTGCGTCGCGGCGTCAGCGCGTTCTTGTCGACGAGGGGCACATGAA
ACGCCCAATCGAAGCAAGCCTTGCGATAACTGTGCCAGAAGCGCCAGTGCGCTATGTAGACGTCCGGGTACGCAAGTGGATCGTAGAACAAGTGTCTGTG
TTCCCAAGGGAATGCTCGCTGGTACGGCTCGAGTCCGAGCGCCCGAGTATGACGGTACACGGCCTTGATGTCGCGAATCACGTCCTTCGGCGTGTCCGCG
CGCAACTCGAAGTCCAGGTGCTCGAGCCACTCGGACGACGGGCGCGACTTCTTCTTGGACTTACTGCTTGCCTGGACGGGGCTAGTCGCCGCGCGCTTCT
TATCCTTGCCGCCGAAGATTGGATGCGCGGCCGCCTCCGTCACTGTCTCCTGCGTTGACGGGTCTGACAGGATCAAGACTGACCCCTTCAGAGCTTGAGC
AGCGTGGTCGGGGTCCTTGAGCAGGGCTTCGGCGACGTCGTCGAGGATCTCCAGGCCTCTCGAGCCTTTGTTGACGGCGAGGATCTGGCGCATGTCGGCC
CAGAACGCCACTTGTGCGAGACGCTCCTGGGTCTTCGTGCCGCCTGGCGAACTTGAGGGACCTGGTCCAAGAAGGCCTTGAACTTGCGCGCGTGGTCCTC
GTTGGTGTCGCTCATGGCAACTGGGGCGTGGCGTGGCTAGAAGGGCTTCGGCTGGTTGCTGTCTGCGGGCTCCGGCGCAAAATTACGAATGACTGCTTTT
CGAGAAAGGCAAGAACTTGACGGACGGCAACTTGTCTGTGATTGACCTTGAACTGACTTGGATTGATGGCTCTGCCTTGACGTATCGCCCTTGGGACGAA
ATTGGACGTTCCTACGGCTGACTTCCGTTCTAACTGACACGGCAAAGTGAGAAAGTACTTCTTATTCTGACTTTGATCGAGTATGGCCAACATGTATACT
GCTCTCGCTCGTTACCAAGAGCGCTACGCTCCTGTCGGGCTGCTTCCTGCCTACTGTGGTGCTGGTGTGTGCTGCGTGCTCGTGTGGGTCATCTCCACGC
CGCTGCGTAACGTCGGCTGGGCTTTCGGCGCGCAGGTCTGGCGCGTCGCATGCTTGAACGGCTCGCTTTGTGCCTGTGCCAATACAACGCAGTGCTGCTC
AATCGCGAGGTGCGAGAGCTGCAAGGCGCTGCGTACCTATATGTTATCTGGGGTGCCCTCTTCGCGGTACCCGTGCGCGTCCTCGAAGACGAGGAAGAGC
GCTATGGCGACTACGGACGGATGCTGCATAAGTGGTGGTTTGCCGCTTACTCTACGTTC