Description :
From Genome Similarity Track
Location :
Scaffold_157:17760- 19072
Transcript NameFunction/comments
Albla_Nc14086610GlycosidePentosideHexuronide (GPH)x3aCation Symporter Family putative

Sequence
1312 bases(100 bases per row)
TGAACTGCATTTTACATGTGGTAAATTTTGACATGGAAACAAAACGCACCAAATACGAAAGCAATCGCAGTCATAATTCCACCAATCAAAACCGGTAACG
CATAACCATAACTGGTACTAACCACAACCGAAGAAAGCGCGAAATTTAATAATTGACCAAAACAACTCGCAGAATTCAATGCGCCCAAACTCATTCCAAC
ATCTTTTTGCTCACCCGCCACATACAAGCAAACTGGAACCATAAAAGATGCCAACGCTGCCTGCGCCAATGCAGTCATAATCACGATGATTACGTCGAAT
GCAACCACTCGGATAGTCGCCATTGCAATTAACATAACTTGAGGGATCAGAGAACATAACAATACCCACTTGAGTCCCAATTTTGTGACGAGAAACGGCA
GCATCCACGAGTAAAGATATCCCGTTACATTAAACAAGATATCTGCTAAGCCCGTGGCTAACTGCACACCGTCGTTGAACTTTTCTTGTTTTATAGTGCA
AGTGTCTCCACAAGTATCGGCACCTGCAGAATCACCACCATAGACTTCATAACCGAAAAATTGACCTTTACCACCGTTATATGCAGTGAACCCATACATT
ACCAGAAATACGATAATAAAATACGCCCAAAGTGTACCACACATGGTGCGTACACACTCGTAGACAGATCGAAAGGAGCCAGTAATTTCACTCCATTTGG
ATTTTTCGTCCGTGCAGATAAACTGTTTTTCATGTGCGAAAAAACACATAACAGTTATACTAACAGCCATCAAAGCTGATAACAATATCATAAAGTAATG
AATCGTTTCATACGCGGGACCGAATATCTGTATGTAAATGGCGATGCATAAGGCGCCAAGAGTCGACCATCCTTGAGCGATCGCTTGTCCCAATGTCTGA
CGATCACCCGCCAAATCGGCCACAAGGAGCTGAACCGGAATTTGGACGATATTTACTGTAATATCCATCCAAATGTAAAATAAAACCATAAACATTGTGG
TCCACTTCCGATTCGTTGGTGTACCCTCTGTACCATCACCGTAATCACCCAATTTGGAGCCGATTACCTTTGTGAATCCCATCAGATTCCAGCATACAAT
ACTCAAGATAGCTGGGAGTAATATCCACACACGACGTCGACCAGTAGGATGCGTGCATCGATCTGATAATGCACCAATGATAGGACCGATGAAGATTCCC
ACAGTGGGACCCACGAATTGGGTCAATTGGACAGCCCAATTGGGCATCATTGTGCTGAGCCAAGGACCCACAGCGGCCCATTGTGCTGCCCATGCAGCAT
TAACAGCCATTC