Description :
From Genome Similarity Track
Location :
Scaffold_557:1776- 6946
Sequence
5170 bases(100 bases per row)
AGCGACTCTGAAGGTGACCTCAGCCTCTCTGGTGATTCTCGGATTCGCTGTAATTCACTGCTGACTCCTGAGGAATTTTCGGCACTTCCTGAGACCCACA
TACCCCGCAATCGTTGGATTCCGGGGTATCGCGATTGTATTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGGAGAGTGAGCCTGATCAGCGT
ATCCGAGCTTGATCTAGACTTGTTCTATCATCACTTTTCAAAGCCCAAGGTATAAATCTTCCCGGTCCAACTGGGCAAAGCTCGCCCTCCTCCGGAGTCG
TTCTGGTCATCCCAGTTGATCACGTCGACCAAGATTGACCAATGTTACGATCAACAACCTTAGGACCTTTATGATCAAACCATACACCCGATCTCCTTCA
AGCCTATCGGCTGGTTCGAAAAACTGGTCGAGGCATATGAAGGTTTCGTTGATAGCCATCGCCAAGCTCTGTGGGAATCGACCCATTTCTTGTTGATTTC
CGCTGGGCAGCGTAAAACGGATCCTGGATTGGCCGCGTTTGCGCTAGCGAGAAGGCAGAGGCGATCTCATGCTGGACCCCGTTGGAAGCGGTTACTGCAG
CTGATTCTTCAAGGGATGATCGAAGGTCTCTGCGATTTGGACATTTTACTGAACCCCATCTTTCTACGCTTTTCCCGTCCGAATGAGGCTAGAGTGTGGT
ATCCCGGCCTTTCCGTGCGGCGGACCAACATACCCAACTTGATCACTGCCCTGTCGATCTATCACGCTACCTAGCGTTGGAGGAACCAGTTTTGTCCTTT
GATCGCATCCCACCCTGGCTCATCTCTTCCACGCTTGGTTGGTAAGTTCTTTGACCGCAAGTAATTGACTTGGTATGTTCCATGACGCGATCTCTCAATT
TACTTTCTTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTTCTTCCATCTTTTTTGTCTTTTCATCTTGATCGCACCGTTAAGTCTGCGATCGTCG
CACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAACCTCCTTGCACCCATAGGTCTCCTCCCCGTCTATGCACCGTCCCTGCATAGACCCATCCA
CTCAAGCTCTCCGATCATCGCTATTCTCTGGCTTCTTCTTCGTGCGATTGTATCACCTCAAAACGATTCTTGCTCACCTGATCGCGATCGAACTCCTGCA
ACATAGCTCCACAATTTAGATCAGCTTCGTCAATCCAAGTTGGGTCGCTGTACTCCTTCCGTTATACCAGGTACTGTTTGTGTATTTGGCCATATCTCGT
CTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTACTTCATCAAAA
TCAAATCGAGTCGCCTCATCCACATTTAATCCACCCGTTGGGCGTTATGGGAATACGCCAACTAGCTTCAGCTTAGACACGTGGACTATTGGGAATATCC
GGTACGGCGTGATCGCCGCACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATA
GCCAAACGCGCGACCTGCGATCGATATCCAATAAATATCGATCTTCATTATGTCGATCGGCTTAACCTCTGATCGCAACCTCCAGTCGTTCATTCACTAC
CGCCCGATCACGTTGATATTGGCGTTGTATACCATATCTCCATCTTCGGGCATCTGGATCCCGGGGTTTGGTAGTTCCCAACGGTATGGTTGCTTCCAAG
GCCGATCTTGGGTCCCAGCCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGATCATGAGCGGTGTTGATCGCATGAATCAATAGCTCTGCGTATT
CGTCTCAGTCCTTTTGATTTTCATCCATGACATGCATCTTGATCGATCGAGTCAGCGTCTGCACCATTCGATCGGCCGTACCATTAGCTTGCGGTCTATA
CGCCAGAGTAGCCTGTAGTTTTTGTCCTGCGATCCGATTGAATGCTCGGAAGAAATCAGATATAAATCCCGGCTCGCGATCATGGCGGGTTGCGTCACTC
GTACCTTATCGTCTGAACACGCACTCCTCGTAATTCTCTGCGATCGTCTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCCGAGAACAAAT
TGACCCACAGCAACAGCTCGGTGTTTCCTTTAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATT
ACCAGGTGATCCACTTCGATCTCCCAGCCTTCCTTTTCCCGTTTCACAATCTACACGCTCTCCCACATACCGCTGCACACTTCGGTACAACCCACGCCAA
TGGAAATTCGCCCTGATCCGTTGATAGGTAAGGCCGATTCCTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGGTGTAACTGTT
CTGGAACCACCAAACGAGCTAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCATCCCACTTTGGTCTACTTCATAGTCCGG
TGCGATCAGGGTGCACACCTTAGCTTCAGCTGCCGATAATTTAGAACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTG
CTTGCTTAATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCTGGGCTGAAAACGTCTTCTCTGGGCTTTTCGAGTGATAGCCGCTAC
TTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGGGTAATCAGGTCCTGACACTATTGATCGGAAACCACAACTGTCCCT
TTCTCTTGCCGTAGAGCTTCACTCGCCAACCGATCTGCACTCTGATTCCAGTCCCGCTTCATGTTTAAGAACTCGTGGGATGGCCACAATCGTAACCTCT
CCATAGCCCTATGCCTCAGCAACTGCAGTCCCGGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTACGCAGATAATCAC
CCGTCCCCTTGCCTGATCGGCAAGCAAATCAAAACTAAGGAGCAGCCCTCAGTATTCTGATTCATTCACGGTTAGATCAGGTGTATACTCGGAAGCAACA
GCCACAATCGTCCATTTCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCTTTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCAGGT
TTTAATTCACACCTACTGTGGGTGGTGGCATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGAGATCGCAATCAATACTTCATCTACTTCTTCATGGGG
TGTTATACTTGCCGCAAGCATACCGAGTATTTCATCTTCTCCCTTCTCAGATTGCCTAACTTCCAACGTTCAGTTCGATAGTAAAGCAGCCCATCTTTCC
AATCTTCCGTTGAGGCCGGAAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAACAGATAT
CTAGCATCCGGAGGAGAGCCAACACTTCTTCTCCACCATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTACGACTAGAGAAAGTGACAGGCCAATACACA
CCATCATAATCCTGAAGCAAAGCAGCTGATACATCCCACTTACTAGCATACACCACGATCACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAG
TTGTGGCTATCTTAGCCTTTAGCAACGTGAATGCAATCATTGACTTCTCCCATAGATTCCTGCCCTCGGGATCGCGATCGTCCCCCGCAATTGGGTACCG
ATCGACATCGATCTCCGGTTTTGGGTACAGATCGCGATCTCCCCCTGCACTCCCTTCGCGAATAGCATCAAGTCTTACAGCAGAGGTAGGTTTTGGAGCT
TCACTCACGCGGTTGATCTCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGA
GACTTCCCAAAAATAACTGCATCGCTCGCAGCGTCAGAGGGAACAGGATGTTCACGAACGATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCGAGCGA
GATTTGATGTCCCAGATAATTCAACCTTGCGACGTCCCCAAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTC
CACTTTCTCGCACAAGGCCTTCCACGACGTAGCTGGTACTAATATGTCATCAATATAAGATCTTCGACCCACACTGATGTTTTTGGATCAGTATCTGGTT
CACCATCAGTGAAGACATCGATCAACTTCGGCGATCCCGCCGTGGTCGATTCGGATTTTACGCCAATTTCAAATACCCATATAGAGCGTTATCGGTCAAA
CATTGGTAAATCTGTGGAGCATTTTTCAACCCGAAAGGAATCCGTAACCACTCAAACAACCCTGAGGGTATGATAAAGGCGGAAATCGCCCTTGCTCTTT
CCGTCATCTCCACCACCCAAAAACCACTCGCCATGTCCTTAGAGCAGTACCACATAGTTTTATCCATGTCTTGCAACAGTTCGCTGATCAGTGGCATCGG
ATACACCATCAACCTAGTGTGATGGTTTAACCGCCTGTAATCAATACACAGCCTTATATCTTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACGCC
CATGGTGATGTAGATGGTCGAATGATCTTGGCCGCCAGTAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTAGTGCTACCGGTCGGAACCGTT
GTGCGATAGGGTTAGCTCCTCCCACGTCGACGTCACAAACTGCCCCACACGCCGCAGGAGGTAGAGTTTTACCCTCTCCAATAAGTAGATGCCGGCTCTT
CCAAATCATTTGTCGCAACTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCGTTATTTCTTGTGTGGGCGTAACC
ACTTCGGGAAGAACCGCCATGTGCTGATCCACATCTTCCGCGAACAACTTGCCGCCATCATGGTAATACA