Description :
From Genome Similarity Track
Location :
Scaffold_357:1776- 6485
Sequence
4709 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTGCTTGATCGTTTCGTTCGTCAGAACCAACATAAAGTCAGGT
TCATCGATCGACTTGGTCTTGATTTTCAGGAACTTTTGTAATTTCTTGCGAGTGATGAACTTCGTCTGGAAACCAGCCTCGTCAACGACACCCATCGTGA
ACATCTTTTCCACGACAGTGCCTCTGCCCCCGGTACTGCTGCCTCTCTTACAGTACCGTCGCGTTTCGACAATTCCAAGTTGTCCTTCACCGCCGAACCC
TAGCCGACTGACGCGTCTCCTAGCTATTCGCACAACAATTCTTGGGCTTTCTTTCTGCGTTGCGTCGCAAACAGTTTCGACCGCAGACTTTACATCCGTT
TCCAGCGCTTCACCTCGACAGGAATCGCGTCTTTTCGCCGATAGGCCTTTCGCCTCGACAGATCTCCGAAGCCCGGAGGCAATCACCGGTCCGCCTTCCT
CGATCGGTTCACAGGTCTCTCCTGTTCGTTTCCAATGCAGAGTCTTCTCTTGTGTTCCTTCGATACATCGACCTCTCCAGTCGATCTGCGGCTGCGTATC
CTCGAAGAATGCGAACCCAAGGGTGCAGTCGATTTAGTCGGGAATGGCGTAGACGACTGCGATACACTTGTACGCCTCGCCCAAACCAGACACCACGAGT
TTGAGGGGAAGTACCTCCAGTTCCGTTTTGACAATCTGGTTGTCTCCGAGTTTCACACGAATGCTCTTATCATTGAACTTGAGTCGATGTTTCTCGACCC
ACTGTCTGGACACGTAGATTGTGGTTGCTCCACAGTCCAACAGCATTCTTTGGGTCGAAAAGGTCGCGCCACTAACGGTGATTTCTCCCTCGACGGAAAA
CAGTGGGCGCGACTTGTAGACGAGAGGGTTTTCGTACAGAATGTTAAGGCTGATATTTTCAAACTTAGCTGGTCCGGCTATGTTCTCCGCCACGACAGGA
CCCTCATTCACTGACGTGGTTACCCGTTTCTCTGTTTCTCTTGCTCCTTCTTCCAAGGGAAGCAGTTGACCTTGATGTGGCCAGGTTTCTTGCAGTGAAA
AAGGTACAACCTTCGGCTCGTTTCGGGTTAGTCTTCGGCTTGAAATGCCCTTTACCACGGAGCACTTTTCCCTTGAACGACTTGTCATGACTCGGCCCTT
GATCAGTGGACGACTTCCGCTTGGCTTGGCGAGTGTGATGTTCGCGCGACTCGTCGACGAAGTGTGTCACCTCGTACTTGACAGCAAGGTCCATTGCGAC
GTTCTGGGTTCTCGAGCTTGAAGTAGCTACGCGTGCGCGGCTTGAGACTATTTGCGTAGTACAGGTCAAGCACGCTCATTCCTTCGATTCGGAAGATCAA
GGCTGAATACTCGCCGTTGTAGGTCTCGATGTCCGTCGTCTGCTTGAGGCGTTGAAGCTTCTCACGCAGGACAGACTGGTAATTCGACGCTTCGAAGTGT
TGGAGTACATGCTCACGGAAAAATCCCCCCCTGTGTGCTCCTCCGCTCGAGTTGTCGAAGATCAGTGCAGAAACCATCCGGACGCCGGCTTTTCCATTGC
CGATCCGGCGATTCCAGGAAGACGCGCGCTCGTGTCTTCAATTGGAATGTTGTTTTATGTGGCAGGCGTTCTCGATCTGGAACAGCCATTCGCGGACGTC
TTCCCCGCTCTTGTCCGTGAAGTTGGGCAGATGGTTCGGCACTTTCGTGCGGTCAGGCATCGCTTGGTTCAGCAGATCGATCTCGGCGCATAGCTGTGCG
ATTGTTGGC