Description :
From Genome Similarity Track
Location :
Scaffold_1122:1776- 4799
Transcript NameFunction/comments
Phyag_g9572hypothetical protein

Sequence
3023 bases(100 bases per row)
CGGCGATGCGGACGGATCGGTTTGTCCAGcggatggagctggatgTTTCCTAGGTGTCCATCCAGTCTCGCTTCGACCTTGCTGTTCATTTTCACGAAAT
GTTACAACAAAGACGCCGCTCTTCGACGATATGCGGATCCGAGAAACTGAAGGTTGCGGCTCCAACATGGCCCAACAAATAGTCGAAGGACTCTGTTTGG
GTAAGAAGAGCTGCGCCCTCAATATCAGCGAGGATATCACGTACGTTTGGGAACCCGATGTCAATTACGGAACAACCTGCTCGAAAGCTCCTACGATCGT
CACGATCGACAGCGTCGCTAACATCACTAAGGAGGTGTGCGAGGTACGACTAAATGATGACAGCGAATACTCAAAGTGTGGCGCCGGTAAATCTCGAGCC
TTGATTGTATACGGACGGTGCTTCACCACACGCGTCGACTTGTCCGGTGCATGGAGCCTCAAGATTATCGGCTGGGACTCCATGAGCGTAAGGCAAATTT
TTGCTTTTGGCTTGATATAGTTTTCATTAACAGGTTGTGATGTAGCGGCGTGAGTTTCTAGGACTTGCGGTAGGATGCGATATTGCATGTAGCCTTGTGT
TCTTCGGCGTTGTAATTTGGCTGCGGCGAAAAGAGAAAGAAGCTGTTGACCGCATCACCCAGGACCAGGTCAAGGCTCTTGACTACACTGTGCAACTTGT
CAATCTACCATACCATGACGACCTCAATTTGCTTCGTCAGGAGGTAAGTATAAGCCTCGTCAAACCGTTCGTAAAAATTCTAACGCAGTTTTTTTGTCGT
GGTTAGATCCGCCTGCACCTCGAAGCTGTGCTGAGCAACGCTTCACCATTCGCAGTGGATCTCGATCGTATTCGCGTTGCTGACGTCCAATTCGGCAAAA
GTGCATCGCGGCATTTACGTTTACTCAAACACCGCGGAGTtgtcgtccaccgtcttgagGTCGCACAGCAACGGCatgagaagctgaagctctTGCAAGG
ACGACTTAATGAAAACGTGTACGCGAGACGTGAGCGACGTCACCTGCGAGCTATGCACAATTGGGAGGTGAAGTTGCATCGTTTTAACGTAAAGTTGGAA
AATTGGCACGCCCACCACAAGCGATACAACATCTCTCAAGCTGTGACTGCTTTCGTGACGttcgaagaagaggaaggttTCCATCGCTGCTTGCAAGAGT
ACCCAGATCTCGGTTGGTTCCACCGCCTTTTCCAGCCCTACTATAAGCGGTTGCATGGCAAACGACTGCGATTTCGTCCTGCTCCCGACCCGACCGATAT
CATTTGGGAAAATCTACATCACTCGTTCCTCGACCGGGTGCTCCGACAACTGGTATGGTACAAAATGAgttttgttgctgtcttGATGCAAGAATACTCA
TGATTGTCCGTATTTGTTTGGTAGCTCGTGGCATTGATCACTCTAGGTGTGTTGTTCGTGAGTTTCATATCCATCTTCGCAgcgaaggagcagaagaGTA
AACTTGACAGACAATTCGAACGGCCAGCCAGCTGTCCGATGAATGTTCTCAAGACGGATGTCATTCAAGACGAGATAAACAAGGTTTCTGGTCTTGTACC
ATACAAGGCACTCGTCGAGTGCTACTGCAAAAACTACCTCGTTGATCAGTACGTTTTCACCTCGCGAACTTCCATAAGCTGGCAAAAATCTAACTTCCTC
TTTGTTACAACAGCTCATTCCGAAGTATGATGTATGAAAGCTTTCACAACCCGGAAACGGGGCAGGATGACATGCTGTGTCGGTCGTGGGCAACCACGTT
TCTGACGACCCAGATCCTGTCTATCGCTTCAGTTCTGCTAGTTGTGGCTGTCAACTTGATCCTGGCGCGAATTCTTAACGGACTTGTTGCCTTGGAGAAG
CACCACACCGAGTCTAGCCTCGTTGTATCGCGCATTACAAAAGTTTTCCTCGCTCAATTTTGCAACACAGCACTATTGATGCTTGTCATCAACGCGAATG
CCGACTATTTCTCCTCTGGGGAGACAGGAGCCAGCACTGGAGGTTTTTCACTGGGCGCGTTGCACGTTTTGACCGGAGAGTACTCGGActtttcagcagc
ttggtaTAACGACGTTGGTGTAGCGCTCATGCTCACCATGATCATCAACTCGCTCAGTACCCACGCGTACCTACTAGCAAACTACACCATGCTCAAAGCT
CGTCGCTTCATGGATCGAGGATTTTCTTTCGATCACTCGCTCACAAAACAAGACACGCAACGTGATCTCGAGGCGCTATACCGCGGACCAAAGTTTGATC
TCGCTTCACGCTACGCACAGTCGCTCACCACAATCTTCATCACGTACATGGTGCGTCTGCATTGGAATGTTTGACCCCTTACTAAAAAAGCTAACCTGTA
TGACTGTTGCAGTTCTCAGCAGGTATGCCGCTGCTCCATTTTATCGGACTTGGTGCAATGATCATGACGTACTGGGCCGACAAATTCAGTAAGTGATCCT
CCAATAGCATCTCTGCACAACCACTAACATGATCTTGATGGCTTCAACAGCATTTCTTCGAATTGCTCGATCCCCACCGCTATATGACAGCAAGTTAGCC
ACGGCGGCAGATTCGCTGCTTCCTTATGCAGTACTGATTCATTGCCTCCTAGCTCTGTGGATGTTCTCGAACGACCGCATCTTCGAGTCCGAAAGCGACG
AAATCTTCGAGAGAGCGGTTGTAAACAGCACGAGCAGCCCTGGCGATGGCATTCCTCTCTTCGATGCAGCACGTCGCGGTCAATTGATCTCTCGTGTCAC
GCGTCCTCAAGTAGTGGTTCttttcgccttcttcgtcgctggttGTGCCATCGTGGTCATGCGCACATTACTTTTCGAGTATGTGCCAGCCTTCGTACGC
AGCATTTTCCCGGCCTTCGCTCGTATGTTGGAGACGCCTCGTGTTGCCAAGGGAATCCCAAACTACTTTGATGGTGAGTCATCGTCATACTGATACATGA
TAAGTTTCTGTCTCTGATCTTGT