Description :
From Genome Similarity Track
Location :
Scaffold_373:1776- 3282
Sequence
1506 bases(100 bases per row)
CCGGCGAAGAACTGGTACCGCCAGCTGGGCCGATCGACGCGGAACAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCCTGGGAGTAT
CGGTCTCTTGGCAGTATTACCATTCTCGCAAGAGATCAGACGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGCTCTGCGTGCGAGATTGAA
GATCAAGGACTGAGATTCCAAGGCCCGCCGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGAACTGGCCGATCGGCTCACTCTACTCCGG
CTTGCGGACGCAGAAGATCTGTAGGAAGTCCTGCGCGCTCGAGAGCGCGCGAAGAGCAGACAGAAGCGATCTGCCTTTGGATCGAAGTATCGTCAGAAGG
TTCCGACCTCAGCATCGGCTGCTGCAACCAAGCGAGCCGTGCGTGTATTGAGGGTTGCTGGTCTTGGGTACTGTGTACCAGTTGTACCCATTAACCGGTT
AACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTAAGTTGTTTACGCCACCGATGATTAGACGAGTAGGATGATTGGATGAACAC
CGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTGTCTATAACAGTAGGGTGTAAGCTCCAACAATTCAATCACTTTCGAAT
CTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCGTCCGAGCTTCGTGTCCAAGATCCATACCTTCCA
TCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCAAGACGCCTCGACCAAGGTCTCCATTGACAAGTTCAACGGGGACAACTACGCGACGTGGAACCGC
TACATGCGTGGCGTGTTCCTGACCAAGTCGACGTGGCATGTCGTGAACCGCGAGACGACGCCGAGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCACTCGACATGCTGGCGGACATCATGACGAAGCCGATCGCGGCGCCGCAGTTCGACGCGCTCAGGACGAAGCTGGGCATCG
TGGTCGCTGACGAGTCGAGTGGGAGTGTTGTCAAGACTGATGTGACGACGCCCCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGT
GACCTTCACTGTGTGGTACCGAAATCATTCAGGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGAC
GTGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCAC
GCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTTGCATTTTGCCAACTACTGCTCAAGTGCTCTTCCTTTTTCAGTGAGGTCGGCGTGACCTTCACG
GTGTTG