Description :
From Genome Similarity Track
Location :
contig_50:177597- 184344
Transcript NameFunction/comments
g8442.t1hypothetical protein

Sequence
6747 bases(100 bases per row)
GCCCATACTTGGCGGCGCTACGCAACGCATTCGCCGGCATCCGCTCGCTCCGGTTCGCGTAGAGCCATTGCACAACGACCAAGTGGCCGTTGGCCGCTGC
ACTGCTCATGGCGTGTTTGGTGCATCCTTCTGGTCGGTTTTCGTGTAGGAAGCGCACAACGTCGAGGTGGCCCTTCCCGGCAGCATAATCCATCGCCTCC
GTGCTGCAAGGCTCACTGCGGTTGTCATGGATCCACTGCACCATATCTAGTCGACCACTGGCTGCTGCGTAGTTCATGGCTCGATACGTGCAACCTTCAC
TGCGGTTCGCATGCAACCACTGCATAACAGGGAGATGGCCATGTTCCGCTGCCGTGTCCATGAGGAATCGTCCACAGCGACTCGATCCTTCGTGGCCTTC
ACCCCATGAAGTGCGTCCTGGGTAGCACTCGTTCAGCCATTCGAGGACGTGCACGAACCCTCGAATGACAGCGGCCGCTGCCATGTACTGACCATTGGCC
CAGTCCGGGTCGCGAGCTGCTGCATATTCCAGTGCTCGTCTCGGCAGCCCCAATCTGCACGCACGCCCAACTTTCTTGCGCGATGAGAACGGATCTAGGT
ACTGGTCCACAAGCGTCACGGCGTGAGACAGCGATCCCACGTTGCGCTTCGAGAGACATTCGCGACAGACAACGAGAGCTGTCGTGAGTTCTGGGAACTC
CTGTCGCTTTGGGGTCTCTATCATCGCCACGTGTAAATCGAGAATGGAGCTACAGGCTGAAGTGCCATCTCGGTGGAGTCAGCAAGAGGCTTCATCCGTT
TTTGCAACCGATCGAAACGGACATCGCTGGATGGATTTGCCACACTGACGTTTACTGGCGAGATGTGGTGGCTCAGCAATGTGCTGTCGCTGCTGAGGGT
GAGCCGCACTCGCTCAAGTTCGTCAGGTACTCAAAGAACTCGGGCAGGTCGACAGTGACTCCATGTTGTGGGAGACAGATATGTTTGCTTAATGCGCTGG
TAAGACGGCTTGGTAGGTTTGTCCACTGTAGTGAAAGCCACGCTTGTTAGTTCTGGATCTCGATAGGGTATTGTTACATGTATTCTATTGTGCACTTCTA
GTTTGTCATGTTGCGGCCTAGGAGGGCGAAGGCGCTAGTCTAGATGGGTCTCGTGACCGCTCTCCGAGGCTCACGACATCTCGCAATGCTGCTACGATTT
GTGAGCTTGCCGGGACGGCAAAGCGCCTGGCGAGATCATCACGGTCAGCGCACGCAGCAAGTCGCCCGGACGGCAGTTCCACCACGTAGGCCAGTACGAA
GGCAAGCATGGACCGCAGCCGAGACGCTGCAGTGTCATCGCTCAGGCTTTGTCCGATAGACTGCACAGTCACTTTGAGCACCGCCACAAACTTGGCCACA
AACTGAGTGAACACCTTCTCGACAGTTTCAATGCGTCCCTCCTTCATCGAGAGCAATTCGCACACAGCAAACACATCCAGTGACGATCCCAAAACCTTCA
GGCAGAATGTGGTAGCTTGCCAGACGATATCCCACAGCACGAGACCAGTCATCTTCAACGGGGAAGCTGCTGTACAGCTCAAGTCACCAGCCGCGACGCA
CTCGGAGAAAGAGCTCGTGAACTCTGACAAGCACTGCAACAGTCCAGTCGTCTGGAGCTCCCACTCTGCAACACTGGGGATCTTGGACTCACTGCCGGCG
TGCTTCGACATTGTAGCAATGCATCTCTTTAATGAGCGGTACCGCTGCTCTTCTTCGCGTAGCTGTGTCTCTTCTTGGTTGGCAGCGCCAGTGACAGGTG
CTACAATCGCAGCCGTGGCAGCTGTCGTAAGCAACGACGAAGAACGAAGAGCGTTCACCGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTT
GTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATT
GAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGA
CAACAGTTGACCTCACCTCCTGACGAGTCTTCGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCG
TCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTC
GTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATA
AAGTGCCGGGGAACGCCGTTGCGGTGACTTCACTCCGGAAGTGGCTGAGTACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGG
TCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTG
GTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTCGCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTTCTT
CTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACGTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATG
TATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGA
TACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCACGGAA
TGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCGCGCCGCCTCTAGTGTGCTGATTCCTTCACG
CTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCGAGGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATACCCGAGGAATTTTGCC
ATCACCTGAGTCTTAACACCAGTTGTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTG
TTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTT
GCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGGTTTCCATGGCGAATTGTTGTTTCCCTTGCGCCAGTCCTGTT
GTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGTGACTTATTCAAAGGCTTTTGGCTTGAAAAGCGCCGATGCAGC
TTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCA
GTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAACTCCCGCGCAGAGCGCAATAGCTGCTGCTGCCACAC
CTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAGGAG
GGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAGC
TGACAGCCGACCCGAGCACTTTCAGCCACTCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGT
CGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTG
GTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATAC
AGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGA
AGTCCGACGACGAAGCTCCCTTCTTCACATTAATTGTCTTCTTGGCGGGACTCTCCTCTTCCTGATTAGACGGGGTCTCCCTCTTCTCCTGCTGGATATG
GGTCTCCTGTCGTAAATGGGTCTCTTGGTTCGATGTCTTCTCCTGCGACACTGGAATTTTCTTCTTGGGTCTCACCTGCATCACTCCTTCCTTAATCACC
TGCTGTCCCCACACGTTGGTCCCGCCCATCCTCTTCTCCAGTAGCGACCTCTTGGCCCACGCGGGCGGGCGCGTGCTCTCTGACGAACCCAAAGGAGGGA
ACGCGATGGTTGCAGGAACCGGACGCGCCACCGATGTGGTCGTCAACAGGGTCGTCGTGATCCTCCGCTTCACGGGCTTCAATTGCGGGAACTCGTGCTC
GAATGACTGCAACGCATCCTTTCGATCTCAGGTTTGGTAGTTGGACCAATTTCTGGTGCGGAATGGTCCTCGGAGACCTGCGTGTTTGCGTGCAATTGCG
TCTGCCCGTGCACAAAGTCCAGGAAAATGGGTACAAAGTCGTCCACGCGCACGCGCCCGAGCGGCAACTGGACGGAGGCGCTTCTGGCGCTTGTGCGGGC
CTCGCATGACGCCAGGGGCCGCGCGGGGTCGACGCAGTGGAATTGGCGCACACTGTGCTGGATGCCGCGCAGCTCCACGTCCGAGAGACCGCCCACGGCC
GCCCAGAGAGACGCGCCGTCCGATGAGCTCCGCGCCATTTTTTCGAAATTGGGCGGTTGCGATTGGTGGAAAAAATAGCGGGTGGACCTAAAACGAGCGC
CCATTTTGACGACTTTTTGACCTGTATTTAGCAAGCTGGTTATGTTATTAGGGTTTGAGATCTTTATGCGATGCAGGCATGATAATATTTATTGAGACGA
CAGGTTGCTCTATCTTACTTAGGAAGGCAAAATGGGCGATTCCGGTTACCTGGCCATTTACTCACCAAATGCATGCAAGACCCACTTGCAGTTTAATCTC
GATTTGATGTCCAAATTGTGCTTCCAGTGGGTATTGTGTGGAACGAAGGTACCGGTGTGCGAAGTCATGGAAAGGGTGAGCTGAACGCACTCAGGATCGA
TTCGAGTAGAGAACAGGCATTCGGGCTTGCTTCGGTCCGAATGCATGACCGAGTTGTCGCCCGGCATTATTATACTTCGAAGTACATGTATTATTGTGCT
TTGCAATCGTTTTGGGAAAACGAGATAGGATTGGTGGATTCAAACGTGCCATGTGGTTGATTTACGATAAACCAAGGTGCATAAAATCGGGCTGGCGTAT
ATTTACGCTAAAACAGCCATTTTTGTGCTTTTGAAAGGGCAATGACGGCAGGGTTGCAACAATTCAGTTGTCAGCCCCAGGCATCGTTAAATCTCACGCC
AATCGAAAATGCGATCGACTGCATTACTAGGGCCATTCGTCATAGTCATGCATGTGCCTGCAGCACATGACAAGCTTTCAAGTGAGGGGAAACTGCAGAG
TTCAATTCGATGCATCCTCCATGCAGATGGAGTTAGCTATTTGTATCGCTTGTAACACACTCTCACGAGAACTGCTTGCCATATTTACCTCCTAAAAAGC
CCGCTAAACAACTACAACGCACAATAGAAGTATTTTAAAATTTATTATTACCGTAATCGCATAGGCAAAGACATCTCCACATCTTCTAGCACAGCATCTT
CTTGAACGGTCGATAATGGCCGCTCATCTTTGATCGTTTGCGCTCGTTCGGAAGTCTTATGTCATCCAGAATTTCAACTTCTTCTTCCGGCTGAAGAGAG
TCCGAAACTCGATCTTCTGCCGGGGGCTCAACCTTCACGACGTCTCCCTCAGACGCTCATCAGACGTCTCATCAGACTCTTGCGAGCTGGAACATTTTCG
TCATCCGAACCGGATTCCGATCCGGACCACTCGGAGTCTTCTTCCCCATCCGAAAGCACTCCACATCACCGTCCTGATTCGCTTGGTGCGCCTCCTGAAC
GGCGGATCCAGAAGTGCTTCTTCTTGGGCCGTCGACTCCTTCGCTTCTTGGGCAGTCTTGCGCTTCGCAGCGTTTGCCTTCCGAGCATTCCTGACGACCT
CATCCAAAGTCGCCTGCTCCTCCGGAGGCAGCCCTTGCACTCGACGTGATGATCGGGACGCATCGCCGCGTTCGATCCCTCACGTCCACCTTCGCATGTG
CTTTCACTTCCAGCCATAATAACCACGGTTAGAAGATTAGTTAGCACCCAGTCCCCTAGAACTCAATCAATAATATAAGAACAACTCGGTGAAATCACTA
GACGTCCAAATCCGGGCACGCGCACCAGCTGAGGCGAGGCGGGTGAA