Description :
From Genome Similarity Track
Location :
Scaffold_443:17758- 18761
Transcript NameFunction/comments
g14314.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CGCCGTTGCCGCTGGCCACGATCCCCGAGTACACGCCTGTGGCGTTGCAGTGCCAGAAGTCGACGTACAGACCCTCCACGGGTTCGCACGTGTTCACGTC
GATGATCTGCACCTCAGCGTAGAGGTCGAACGCCCTCCTGGTCCTCACGGACGTCGGAGCGCACGAGCTCGCCGTTGACGTAGTACGGACCCTGCGTGAC
CTCAGGTTCGAGGATGCACTTGACTTCGTCGCCGAAGAGCTCGCTGGCGTCCGTCTCGTTGGTGAGGCCGGTGAGGTTGGACTTGTGGCTCGTGGACACG
ACGGTGTCGACGTCGAGGCGGCGGCGCTGGCGACGTTCAGCGCGGATGCTGTCGGCCTTGGCGGCTCGGCGGGCCACGGCGCGCTGCTGCAGTCGGCGCG
AGGCCTCGGAGTTGGCGCAGTCCTTGAGCGAGCGCTTGCCCTCGGCCATGAAGAGTCGGCGTTGTTCGAGTCGCTCGGGCGAGCGCGCGTGAGCGGGTTG
GCCTCCGTGTGCGGACACGGAATCGCGAGATGCGAGCGCGACTATGGCTGCGGTGGCAACGAGGAGGGTGGTGGAGATGCGGACCATGCTTGCGCTGGTT
GGATGTCGGTTCGTGTTGTGGTGGAGCTGGAAGTGCCAGTGGGGTTGGAGTTCGTTGTGCGTGGAAGCTCGCAAAACGGAGAATGAGAGACGAACGCTGC
GGTGGTTCGTTCCGAGGGTGCTGGTCTCATTGTTCCCCGGTCTACTTGGGTTGACCAGGTCGCCGGTGAGGCTCACGTCATGTCCAGGTCTACCGGTTTC
TGGTCGCAGAGCTCTTGTGCTCAACACATCGCTCTAGTCGTAGCACGGCTGGTCTTTGTGAAGTAGTCGGAGAAATTAACTACCAGCTGGTGCTGGGTCA
GCTATCGCGATGTAACCTCTCGATATGTTGCGGGTGCCACAATACACTTCTCGGCATACTGTATAATACAACAAACCGGTTTGCCATGAGATTCCGTAAC
TTA