Description :
From Genome Similarity Track
Location :
Scaffold_121:177533- 181758
Sequence
4225 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCCATCCAGGTTGTCTTATCC
GCCCTTATGATCCTCATCGTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCA
ACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAAGACACCAAACAACCTGC
CAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACC
TTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTC
TGAACCACTTTCCTGGGGCGTGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGAC
CTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTT
TGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTAT
TATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAA
ACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACCTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATT
CTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACA
GACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTAC
ATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGACCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTT
CAGGGTCAGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTT
TTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCAATCCACCGCCCGCAGCACTTCCTCAAACTCGTCTGCGTCGGGGAGT
CGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGACCATCCTTGATCTTCAA
CTTAGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGTGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACT
CCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTAGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCG
CTAGCAGATTCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTC
ATCTTGATCCTTGCCCGTGAACGCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCT
ACCACTGCTGACGAAGTTGATGGGC