Description :
From Genome Similarity Track
Location :
contig_62:177528- 179743
Transcript NameFunction/comments
g9239.t1hypothetical protein

Sequence
2215 bases(100 bases per row)
ACAGCTCATCAAGTAGAATTTTACGAGCAAAGGTTGTGTACAACCTACCAGAACTTCTTGTCTAAAAAGAACAAGGAACAAGTAGTGCTAGCTCACAGGC
TAGACGAATTTTCACCTTCACCCATCTGGTTGTTAAGCCACGAAAGCTTGCAATGCTTAGGCATACATTGTGCTCCCATCCGAAGTGCAACTACATTTGT
TCTCCTGTCGCTGTCGAATGCTATAATACCAAGTTTACGGGAATGTGGGATTCCCGTAAACTTGTTGTGTGCTCGATGCCGCCCGCCCCCCCCCCTCAAT
TCGTAAACCTCTCCCAACCACCTACTTCGAACCAAAGTCCCTTTGTTCAGCAGCTAAGTAAACTGCGCCTGACACATATCGCACTTGTGGCTGCCGTTGG
CCTCCTTACCCAAGTTGACGTGACTCGGACCCCGCGACGATAAACTCGAAGCCAGCCATCCTGACTTGCCAGCATTGATCGTTCGCCCCTCGCAGCAACA
GACGTCCCAACAACAGGCGTCTAAGAACTGACACAAAGATGGACAATGGCGAAGAGAGAGGAATCAATTTCGACAAAGCCAAGACCTGGATCATGCCGAA
GTCTCTAAACAAAAACTCGAACGCTGGCTAACGAAAGAGAAGCCTGTTGAAAATGTCTTTACGCGATTGCGACTTCGACAGGCAGGCGATAAGCTGCTCG
GTGACCCCCAGTTTGCAGTTTGGGTGAAATACGTCGACGATTTAAGCAGCAGGAATCCCAAGAAGACAACGCTGACGATCCATGTGCTGCTTACACACTA
CAGCGACGAAGCTCTGGTTAAAATGGTGGCAGATGTGAAGACCATCCCGGAAACCAACACATTTGCAATCAGGTTGCAGAACGAGCTAGCCGAGTATTGG
TTGACGAAAGGGAAAACACCAGGCGGCATCTTCACTCTGCTACAGCTTGACAAGGCCGGAGATGATATTCTGACAAGTCAAACGTTTAGCATCTGGAAAA
CGTTCTTGAACACGTTCAACAAGGCGAACTCTGGCAAGACGGTGAGTATGTTTGGAACGTTGATGAATCAATACGGCGAAATCGGTGTGTCAAGAATAGT
GGAAGCATTGAAGGTCAAAAGTTCAAATTACGTCGCCAAAACAGTTCAAGCGAGCAGTTCCAGCGCTGGATAAGACGTGGAGAGTCTCCGAACGCAGTTT
TTGAGCTGTTAAAGCTGGACGAAGCAGGTGACAACCTCCTTGCTAGTCCGTTGTTGGATACATTCACCAAGTACATGAGTACTTTCAACATGCAGCATGG
GGAGCAGCAAGAGACTTTGATCGCAGTGTTGACCAAATACTACGACGTACCAAGCCTTCTAGCCGCAGCAAAAATAGTTCCGAGCACATCACGTCTTGCC
AATAAGTTAGAAGCACAGCAGTATCTGCACTGGCTGAAGACTGGCTACGACCCCGAAACTGCCTTCATTCTGCTTGGACTTGGTGATGCAGGAGAGAAAC
TTCTCACCAAATCAAATTTCGCTACTTGGCTGAAGTACACTGATGCTTTTCACGCTGACAACCCGGACACAACATTGAAAACCTTGAGTATATTACATAG
TTACGCCAAAGGTGCTGGGGGTTGCCCCTTTCGGACGCTGCTCTAGCCAGAATGACGGCGATTGCAGAGAAGAATCCGACTACGATAAATGTTGCCAAAC
GAATGAAAGCTGTCCTGTTCCAAGGGTGGATGCGTAAGAGAGGTCACAAGACCACTGACGACGTCTTCACCATGCTAAAACTTGATGAAGCCGGAGAAAG
ACTGTTTCAAAACCCCATGCTTGAACTTTGGATGAAGTACGTGGATGGTTTCAACAAAGCGTTCCCAAAAGAGAGAGAGGGTATGAAGATTCTGACGACA
AGCTACGACGACGCAGTTCTAGTGAAAATGATCGAATTGGCGAAGAAAGATTCGAGTACGAAAGAAGTGGCCACCAAGGTCCAGAGTGAGATGCTTACTC
AGTTCGCGAACGCTCAAAAGAATCCGGCGTATGTTGGCAAGCTGCTAAATATCAAGGACAAGACGGATGCGAACTGGGGTATTTGGAAGAAATATCTGCA
AGGCTATCAAAATTTACACTCCCCGCCATGACGTAGGACGCTTGAACAGCTCACAAACGCGTAGGATGATATACGGACGACAAACCTGGTATTAGTTGGA
ACAAATAGTTGTTTC