Description :
From Genome Similarity Track
Location :
Scaffold_19:17744- 23914
Transcript NameFunction/comments
Physo_250995Eukaryotic/viral aspartic protease, active site

Sequence
6170 bases(100 bases per row)
GATGTCGCCATGGAGTCGGTCAGGTCGCGTTCTTCGACGAGGTCCAGAACTCGACGCAACGCAGACGAGGACCCCGATGACCTGTTCGACTTGGACATCG
GAGTGCCAAGAACCGTGGCCACCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACACCTCTCAGCATCTTCCGAGCTGAAAGAGTTCTC
GGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCATCGGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAG
TTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTGCGTGTGC
AGTACTGCAGTAAGGGCGTGTCAATGGCCAGCCGCTACTACCATGCGGCTCAGCGCCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCG
CGGGTTTGAGGGCCAACATCCCATACACCGAGGGTACGACTGAACAGAAGGGCGAAAACGTCGAGCATTTCATCCGGACGCTGAGCACGCAGGAGACCGA
ACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAACTGCGTGCCCGACAACGGGGACTGGCCCACCAGAAAAAGACT
CTCTTCGGCTCGAACAAGTTCCGCCAAAAGTAGCCGACCCCACCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGACT
CGGGACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGG
AGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTTGGGACGCGACCGCCCGCGGTGCCGCTACTGTGGTTCACGTCGCCATGTCGAAGGAGACTGCTGG
AAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCAGGAGAATGCC
CGATGGAGGAGTTCTTCAGCCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCTGCCGGCCGCCGAGAAGATGTCAAACTAGGACGC
TCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAACCCGACTTCCC
TGAATGATAATACATGTGAATTCAACCTGGAACGTGCCACGCAAGAACGCGCGCGGCGAATCTCGGCGGTCCGATGTACGACGCACGTCGAGTTTGCACG
TGAACCTCCCCTGGACGAGATCGAATTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACTCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCAT
GGAACGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGCGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGAAGGCTGCCTGATCG
ACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGAAACTTGGTGGA
CTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACACAATCCTCGGAATGAACTTCATGGTGCCCGCTGGAGTGCGGATCGACACTGCGGACGGC
ACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACAGCGCACGGATGCACCCGGTCGATGTCAAGACGCCTGTGAGAC
TCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTCGTGCGTGACTACCTTTGTCAA
AGGGAGAGTCGGAAGGAAGACGTACCTGCGTGTCACGAACATCGGAGATGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTAGACGCCGTCT
GACGGCCAGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCACGACGCGGAGGAGA
ACTGGATCCCAGCCGAGCTGGACGGACCGATGACGGATCGCTCCTCATACCCGACGCCTAAAGCCTTCTTGCGCCCGGAGCCGAGACAACTCGGGACGCG
ACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGTGGAAGCGCCGAAGGCAAGGGGGGTAGACTTGCCACCCGACGACCACAAACCGGATACGAACGAGGAG
GCGGTGGAAAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCACTGCGATGGAAGAATCGCCGAAATCGGAACTCGCCGAGCCAAAACTCGACGGAC
CAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGATGCTGTCCTCATCCACGAGGGGTCCGACCTCTTCGCCGAGGA
TCTCGAGTCCGAGATGGCAGTGGTGTCACACCTCTCGCTGACCGCCGAGGTGAAAATCGAAGACTTAAAGGTTGGCATGCCGACTGGACTCCCGCCCGAG
GAAGCCGCAATACAAGAAACGCGGCTACGCCAAATCGTCTGGAAGCGACGAAAGTGGTTGATCGACAAGGGCAACGCCTTGTCGCCAGCCGCCCTGGGTG
TTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGTGCAACGCGTCCGGAAAATCCCGCCGCAGTTCCGAGAGAAGGTCGCACACTTGATCAAGGG
GCTGCTGAGCGCGACGATGATCCAGAAATCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATT
GACTACATGCTCATCAACGGGCTGACACAGTTGATGGTTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCT
CTATCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAAACCGGGCCCGGCTCATCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGTGCGT
ATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGGG
ACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTACATCGACGACATCCTCATCGGGGGCACGTCGTGGGA
CGACCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCGAC
TACCTGGGCCACCGAGTCTCAGGACTCGGTCTCGAGGCGAAACCGAAGAATCTGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGATCAAGGGCCTGC
AATCGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATCCGCTGACGGAGACCGACTTCAGCGA
GTACGTCACGCATCCAGAAGTCCGCGAACATGAGAAGTGGACGCACGTGACGCGCGCCTTCGACGCGCTCAAGGCAAAACTCGCCGAGACCCCAATGTTG
AAGCACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGGGATACTCACGCAAATCCACGACGCTGTGTACATGC
CTGTGAAGTTCATCAGCCGTACGCTGAAGCCCAACGAGCTGAACTACGACATCGTAGAAAAGGAGATTTTGGCCCTGTTGCGCGTCTTCAACGAGTGCTA
CACGATGCTAGCAGGGAGACCGGTCCGCGTCTTGATACGTCACACGACGCTCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGGCTGTCACAGTGG
GCCGCGATCCTCTCGCCGTGGAAGCTGGAAATCTACCGATCCATGAAGGGAGAAGAAGAACGCCTCGGCGCGCTAGCCGCGAGCATTACACCGCGAGCCT
TCGTCGATGCGGCGCTAGAAGAGATCGCCCCACGGAAACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCTGACGTGGCGCGTAACGAAGTCTTGCACGT
CTTGAGCTTCGACGGATCGGCTAAGGCGAAACGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCACCGCGTCG
GGATATGCGACGGACCTCACGGTCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAACTCGACGACGTCACCCGACTCGTCG
TATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAACGCACT
CCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGC
AACGCGCACAGCCCAAAGAGATTCAAGATCTGAAGTCGCTGAATCGCTTGAAAGAAGTCATCCGACCACGGGCATCGAGTCCCGAGATGGCGTCTCCAGC
CAGTCCCGACGCGGATAATCTCGACGCGGATAATCTCGACGCGGAAAACCTCGACGCGGAAAATTGCGACGCGGAAAATCGCGACGGGAAGGCCATGGAC
GCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACATAGGGTCCGACCTCCAGAAGTCCTGGAGGAGC
TGGTGGTGCAACGACTGCGCCTGGACCGCGTCCGCGTCGCCCAGGACGAAGAGGTCTGGATCATCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGA
CCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACCAGCCGAGAAGCGAGGATTCC
GCCGAGGACCGCGATGTGATGATGAAGATGGTGACCGCGGAGACTCTTCAGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAAGGCGGACACCAGG
GTATTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGACGAATGCACCGACTGCGAGAC
GGGAAAGTGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCACGACGTACCTGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCG
GCATCCTATAAAGGCAACACAGAGCTGTTAGTATGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCGTCACGAACCGCGCAGACGGTGG
CCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGTTTCATGTCCGACTTCTTCAAGGCGTT
CAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTCGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATC
AAGATGTACATCGCGGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAATACGTCGCACGACCGGACGAGGAACGAAA
CCCCGTTTTTCTTAGTGCGCGGCTGGGATCCTCGGTCGAGGCTGGAAGCGACGCCGGCCGTCGGGAACACGTCTACCCGGGACTCCGAGGCGAGGCGGTG
GAAACTCCGCATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGGGAGGCCGTCGAAGAGAGAGCGCGTCGACAAGCTGAAAAC
TCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTCATGCACA