Description :
From Genome Similarity Track
Location :
Scaffold_301:17743- 20684
Transcript NameFunction/comments
Phypl_g6686hypothetical protein PHYSODRAFT_509192

Sequence
2941 bases(100 bases per row)
gctgctggtgctgggcgtgttcTTCCACGCGCTGTACGTGCTGAGCATCTTCGACATCTACTTCACGTCCCCCGTGGTGCCGCACATCGAGAGCGTGGCC
TACACGGACTCCCCGCCGGCCAAGCGCGTAGTAGTATTCGTAGCCGACGGTTGTAGAGCAGACAAGTTCTTCGAGGCGAACGCGTCCTCGGACGCCCAGG
CGGAGCGCCGCGTGTCTTTCCTGCGCAGCGCGATGCAGACGCGGGCCAGCTGGGGCGTCTCGCACACACGCGTGCCCACCGAGAGCCGCCCCGGCCACGT
GGCGCTCTTCGCCGGCATGTACGAGGACGTGAGCGCCGTGACCAAGGGCTGGGCGGACAACCCCGTGGACTTCGACTCGGTGTTCAACcagagcagcgcc
gccttcctcttcggcaGCCCGGACATTGTCCCCATGTTCGCTCGCCACGTGCCCCAAGCGCGGGAAGAGCACTATTCCCACCAGGAGGAGGACTTTGCCA
AAGGAGACgcgtccgagctggacgtgtGGGTCTTCCGCCgcctgcagaagctgctgagcaatGCCAGGCAggatgacgagctggatATGAAGCTGCATGA
TGACGGGGTGGTCGTGTTCTGCCACTACTTGGGCATCGACTCCAACGGACACGCACATCGACCGAACTCGAAGGATTACCTCAACAACATTGCActggtg
gacgagctggtggagaagacccATCGCTTGGTGGAGGACTTTTACGACTACGATGGACGCACGGCCTACGTGTTCACGGCGGACCATGGCATGGGGCTGA
AAGGGGCTCATGGAGACGGAGACCCGGCGAATACGCGGACCCCGTTGGTGGTCTGGGGGGCGGGCGTGCAGGGGCCGACCCAGGTGGACACAGACGGATT
CGAGATTGACCTGCCCACGCAGTCCCGAGCGCAGGTCAGGGCTCAGCTGCAGGCtcaggaagagcaggaacaagctgctgtgggCGAGTGGGgggcgctg
gacaagctggtgcGCAAGGACGTGATGCAGGCTGATGTGGCGCCGCTAATCAGCGCACTGTTGGGACTGCCATACCCGCGGAACTCGGTGGGggtgctgc
cgttctcgTACCTGGCCAAGGGGGCGTATCGGGCGAACGCTGTGCGCTCGAATGCACAGCAGCTGTACCTGCACGCACTGAGAAAGGAACAGGAGAAACG
CTCGCGTACGCTGTTGCGTTTTGTCCCTTACGGTCCGTTCCGTGACCGTGTTCCCGAGCTCTCGAAGCAGCTTGCAGAAGCGTATGAGACCAGCATTCTG
AGTGACGAAGACTCGGAAGTATacgagcgcgtggaggtGCTGAGTCAGGAACTGATCGAGATCTGCTTGGCGACTCTGGAGTATTTCCAGAGATACGACT
GGTTTTTCCTGCTCAGCGTTGTGGTACTGGGTTACGTGGGGTGGATGGTTGTGCTGGTGGTAGCCTACCTGCACCCTCGAGACTTCAGCTTGAAGTggct
gcttggtgctggtggcaagcagctggacATCAAGTTGGTCACTGTGGTATTCGCAGCCTTCGTGTACCTGGCTCTCGAGGGCTCACCGGCCACGTACTAT
CTCTACCTGCTGTTTCCTCTAGTCTTTGGAGCTTTCACGTGGAACCATGCTGACTTAATTCGGCAAGCGTGGGACTCTGGTTCTTGTGGAAACACATTTA
AGTCTGGTTGGAAGCGGTGGGCAGAAATCGCGCTCATTTTGCTGTGTCTAGAACTTGTGGTGTTTGGGTATGAACGTCGTGAGGTTTTTGGCGTGCTTTT
CTCGCTGCTCGCGTTCTGGCCCTACGTTGGGAATGCAGCAAGTGATGACGAGGACCAAGGAAGTGAaagtggtgcagctggatgGACTGGGGGCTTCCCG
TCGCCGAGGCGGTGTTGGACGATCAGTTGCCTTCTCATCTCAGTGTTTCCGTACTTGCCCAGCGAGTATGGCGAGCACACTGCGCTTGTGAATGTTGGCG
GCTTGCTGACGTTGCTTTTCACCGGAATAGTGCTGAGCATGGCAGCATCTGACCAGCAAGCGGGATGGAAGAGCTCTTCATTCATTCTGAGTGCGTCGCC
GTTGGTGCTCTCTTTGGTGACTTTGCACGGCACAATGCAGTACCTCGATGGTGACCGAAGCAAGCCGCCATTTTCGCTCACGGTAGCTAACTGGCTTCTG
TCTGGTGTCCCTATCGTGGTGCTCCTTGTGAGATTACAACAGAGCAAACATATCCTATCTCGTACCCTAGAAGTTGGTGCCGGCCGTCATGACCGGCAAC
TACTCCAGGCCGAGGTTTGCCGCTACGTGAGACGACTCATCGAGGTGATGTTAGCCTTCGCACCGTCGTTCATTCTCCTGAGTATTGCCTACGAGGTGTT
GTTCTACGTGGTGCTATGCGGTGTTCTTGTGAGCTGGTTGTTATTGGAGGCCCAAGCCTCAAcggcatcttcatcttcgatGTGGCGCGAGATTCAGCGC
GCGTTTGTGTTTTTGCTACTGGTGAATATCGCCTTCTTCGGCACGGGCAACGTGGCTAGTatgagcagcttcgagatctCGTCCACCTACCGCTTCGTCA
CGGTATTTGCACCGTTCACCATGGGTGCGTTGCTGGTGGGCAAGATCCTCATCCCGTTCATGGTGGTGGCCTGCACGTTCCACCTGATCCTGCTTCTTcc
gtcggcttcgtcgtcagcagACAAGAACAAGCCCCGGCTGCCTGCCACGCGCTACTTCCTGTTGGTCGTGACCATGTCGGACGTGCTTGCCCTCCATTTC
CTATTCCTGGTCAAGAACGAAGGCAGCTGGAAGGAGATCGGAAATTCCATCTCAATGTTTGGTATCGTGAACGCGCAAATCGTGTTCATCCCGCTCTTGT
TCCTGTTGGCACGCGCATTCGTCCAGGACCTCGCACCTGCT