Description :
From Genome Similarity Track
Location :
Scaffold_357:1774- 6485
Sequence
4711 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTGCTTGATCGTTTCGTTCGTCAGAACCAACATAAAGTCAG
GTTCATCGATCGACTTGGTCTTGATTTTCAGGAACTTTTGTAATTTCTTGCGAGTGATGAACTTCGTCTGGAAACCAGCCTCGTCAACGACACCCATCGT
GAACATCTTTTCCACGACAGTGCCTCTGCCCCCGGTACTGCTGCCTCTCTTACAGTACCGTCGCGTTTCGACAATTCCAAGTTGTCCTTCACCGCCGAAC
CCTAGCCGACTGACGCGTCTCCTAGCTATTCGCACAACAATTCTTGGGCTTTCTTTCTGCGTTGCGTCGCAAACAGTTTCGACCGCAGACTTTACATCCG
TTTCCAGCGCTTCACCTCGACAGGAATCGCGTCTTTTCGCCGATAGGCCTTTCGCCTCGACAGATCTCCGAAGCCCGGAGGCAATCACCGGTCCGCCTTC
CTCGATCGGTTCACAGGTCTCTCCTGTTCGTTTCCAATGCAGAGTCTTCTCTTGTGTTCCTTCGATACATCGACCTCTCCAGTCGATCTGCGGCTGCGTA
TCCTCGAAGAATGCGAACCCAAGGGTGCAGTCGATTTAGTCGGGAATGGCGTAGACGACTGCGATACACTTGTACGCCTCGCCCAAACCAGACACCACGA
GTTTGAGGGGAAGTACCTCCAGTTCCGTTTTGACAATCTGGTTGTCTCCGAGTTTCACACGAATGCTCTTATCATTGAACTTGAGTCGATGTTTCTCGAC
CCACTGTCTGGACACGTAGATTGTGGTTGCTCCACAGTCCAACAGCATTCTTTGGGTCGAAAAGGTCGCGCCACTAACGGTGATTTCTCCCTCGACGGAA
AACAGTGGGCGCGACTTGTAGACGAGAGGGTTTTCGTACAGAATGTTAAGGCTGATATTTTCAAACTTAGCTGGTCCGGCTATGTTCTCCGCCACGACAG
GACCCTCATTCACTGACGTGGTTACCCGTTTCTCTGTTTCTCTTGCTCCTTCTTCCAAGGGAAGCAGTTGACCTTGATGTGGCCAGGTTTCTTGCAGTGA
AAAAGGTACAACCTTCGGCTCGTTTCGGGTTAGTCTTCGGCTTGAAATGCCCTTTACCACGGAGCACTTTTCCCTTGAACGACTTGTCATGACTCGGCCC
TTGATCAGTGGACGACTTCCGCTTGGCTTGGCGAGTGTGATGTTCGCGCGACTCGTCGACGAAGTGTGTCACCTCGTACTTGACAGCAAGGTCCATTGCG
ACGTTCTGGGTTCTCGAGCTTGAAGTAGCTACGCGTGCGCGGCTTGAGACTATTTGCGTAGTACAGGTCAAGCACGCTCATTCCTTCGATTCGGAAGATC
AAGGCTGAATACTCGCCGTTGTAGGTCTCGATGTCCGTCGTCTGCTTGAGGCGTTGAAGCTTCTCACGCAGGACAGACTGGTAATTCGACGCTTCGAAGT
GTTGGAGTACATGCTCACGGAAAAATCCCCCCCTGTGTGCTCCTCCGCTCGAGTTGTCGAAGATCAGTGCAGAAACCATCCGGACGCCGGCTTTTCCATT
GCCGATCCGGCGATTCCAGGAAGACGCGCGCTCGTGTCTTCAATTGGAATGTTGTTTTATGTGGCAGGCGTTCTCGATCTGGAACAGCCATTCGCGGACG
TCTTCCCCGCTCTTGTCCGTGAAGTTGGGCAGATGGTTCGGCACTTTCGTGCGGTCAGGCATCGCTTGGTTCAGCAGATCGATCTCGGCGCATAGCTGTG
CGATTGTTGGC