Description :
From Genome Similarity Track
Location :
Scaffold_1396:1774- 3670
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_1396-abinit-gene-0.9Myotubularin
Pytar_ATCC12531maker-par_contig_1396-fgenesh-gene-0.2Bzip transcription factor

Sequence
1896 bases(100 bases per row)
GGCTACGCTGCGTGGTGTGAGCGAAGCGTACCCATCGCATCGTCGAGCTACGGCCAATGCAAGCGATGATGACGAGGATGACGCTTGATGACATGACGAG
ATCTAGTACTACAGAAGTGCTTTGGATGAAGAAGATGACAGATTTCACCAATCCACCAGACAAGTGAATCACCACCAGAGTATTAATATTCCAAAAATGA
CGTTCGACGGTGCGACCACCACGTGGTTGTTACAAAACACGTGAGGTCGGCTCTGGTTGGGGAGAGAACACCAAGGAAGCCGTGGTGTGCTGACCTTCCT
CGACCGCCTCTCCACTTTTCTGCTTCTCTTCTCCCGTGCATGGAAGAACTCGACTCTGTGGCTTCTTTTCGCCACATTATAATACATAGATACCTCTTTC
CTCATCATAACCATCACCTTAGTCTAGCACGTCAACTGCCCTGTGCCGGGGGATTCGCTTTCTCCTCCAAGTCGCCGTCGTCCTCGCCGACAAGAAACGA
GATCCGTAACTTCTCCTTCGCTTGAGCCTCTGTCTCCGCCTCTGCTGCTGCTGCATCACCATCTTCTTTCTCCTTTTCTTTCTCTTCTTCTTCGTCTTCT
TCTCTGGGATCCGAATCGAAGTCCACGCCAATCTCCTCCAAGAAATGGTAGTCCTCGGCTTGTAGTCGATCTGGAACTTGGCCCAAATCCGAGACCACAA
AGCCCTGCATGATTTCCGCGACGTCTTCAACTCGGCACCCGGCACTGAGCAGGGCATCGGCGAGTTCGATGTTGGCGGTCTCGGCACTGATGTGGCCGTC
GGCGGTGAACTGGTAGATGCCCACGACCGGACACGGAACGTACAGGCCGATCATGCGTTGCACGAGCGGTTCGTTGTGGATGGCGTGCGGGAACAAGTAC
TTGACCGTATTCCGTGAGAGGATGACGTGGTATGTCGTGAAGCAGTAGAGAATCGGGTCGTCTTCTGTGCCCGAGATGCTTACGCGATTGACTTCGCCAA
CGAACGACGCGTACGACGCCGTGTAGTACCCCCACTGTGCGACGCAGCCCGCGGGACCCTTGTGGTCGCCGTACACCGTATCGGGATCGATGACGCGATG
CAAAAACTCGAGCTGGGTCTTGGCCTTTTGGACCGCACTCGTTCGGGATGGTGGTGACGCCTCGGCGCCGGTCGCGAGCGGTCGTTCGATTGCGATGCCG
TACCGGAAGAGCGTAAAGTACTCGCGGACGAGTTTCTCAAGCGAGCCGTGCGCATGGTGGCGCTTGAGCATGACCTTGGACGCGTAGATACTCTTCTGCA
TCACGAGCTCCGAGACTTCTCGCCGCAGCGCCACGACGCGCTCCTCCAACTCCACCACGTGCGACTTTCGCCGCTCGCGAAACTCTTTGCATCGCTGGCG
ATTCGGTTTCGGTGCTTTCCGGCGCGTCGTCGGGGTCGCGGATGACGCAGCGCCAGCGGGGCCAGAGGTCGGACGTACCATGGCTGACGTGGTGGTGGTG
GCGGTGGCGGTGGTACTCGTGGTGGTGGTGATGTCGGTGCTGATCAACTGTGGCGCTGCAATGGCAGGTGGCCCACGTGGATCCGGCCGGTCCGTCCGTC
TGCGACGGTGGCCCACGGGCCGGTCCCCCATGGCTTCAGTCGTGCCCCTCTCGTCCTCGATATTCGACGATCGGCGTCGGAGCGAGAAGCAGAACTGGAN
NNNNNNNNNNNNNNNNNNNNNCGAAATCGTTTTGGAGCTCTTGAAAAGCGGACCGCCCGTCCAAATAGGACCGGCTAGTATGGTAATTTTACAAACCGCA
GAACTGACTGGTTTTGATCCACTATAGCGTCGTTTGATTGGCTGAAATCCAGAGGTGGCAAGTCATGGCACGTCCAAAAAAGAGTTTTTACCAGTC